Open Close
General Information
Interaction Type
Interacting Genes
FlyBase ID
FBig0000104269
Interaction Network
Interactions Browser links
mir-14 network
sug network
esyN Network Diagram
Show neighbor-neighbor interactions:
Select Layout:
Legend:
Protein
RNA
Selected Interactor(s)
Common Interactor(s)
Reported Interactions
FBrf0212621-1.miR-mRNA.PCR
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note

mir-14

bait
sug 

sug

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Mutation of mir-14 increases sug mRNA levels.

Source was adult heads of mutant fly line; bait produced from endogenous gene; prey produced from endogenous gene.

FBrf0212621-2.miR-mRNA.GFP
Description
physical association
Collection
Cell line used
Participants
Corresponds to
Reported as
Role
Note

mir-14

bait
sug 

sug

prey
sug 
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
sug 
3-prime UTR
sufficient binding region
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

GFP reporter assay

Source was adult brains of mutant fly line; bait produced from endogenous gene; prey produced from transgenic reporter construct.

Mutation of mir-14 increases sug GFP reporter expression in insulin producing cells.

FBrf0212621-3.miR-mRNA.LUC
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note

mir-14

bait
sug 

sug

prey
sug 
sug 
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
sug 
3-prime UTR
sufficient binding region
sug 
mir-14 target site
necessary binding region
AUUUAACGUGAUUAAAGACUG
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

luciferase reporter assay

Source was S2 cell line; bait produced from transfected construct; prey produced from transfected reporter construct.

External Crossreferences and Linkouts ( 1 )
Linkouts
MIST - An integrated Molecular Interaction Database
References (1)