Open Close
General Information
Interaction Type
Interacting Genes
FlyBase ID
FBig0000104514
Interaction Network
Interactions Browser links
mir-7 network
aop network
esyN Network Diagram
Show neighbor-neighbor interactions:
Select Layout:
Legend:
Protein
RNA
Selected Interactor(s)
Common Interactor(s)
Reported Interactions
FBrf0189914-1.miR-mRNA.IHC
Description
physical association
Collection
Cell line used
Participants
Corresponds to
Reported as
Role
Note

mir-7

bait
aop 

Yan

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Source was larval eye discs; bait produced from transgenic construct; prey produced from endogenous gene.

Overexpression of mir-7 reduces aop protein levels.

FBrf0189914-2.miR-mRNA.GFP
Description
physical association
Collection
Cell line used
Participants
Corresponds to
Reported as
Role
Note

mir-7

bait
aop 

Yan

prey
aop 
aop 
aop 
aop 
aop 
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
aop 
3-prime UTR
sufficient binding region
aop 
mir-7 target site 46
necessary binding region
AUCACCGCACUACAUCCAUCUUCCA
aop 
mir-7 target site 1118
necessary binding region
AUAGAAAAACAUUGGCUUCCA
aop 
mir-7 target site 1312
necessary binding region
ACGAUCUUACCACCACACUUCCA
aop 
mir-7 target site 1602
necessary binding region
UCGCCACAAUACCUGUUCUUCCA
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

A GFP reporter fused to the 3\'UTR of aop was downregulated in photoreceptor cells. Mutation of the four predicted mir-7 binding sites in the aop 3\'UTR abrogated this downregulation.

GFP reporter assay

FBrf0214819-1.miR-mRNA.IHC
Description
physical association
Collection
Cell line used
Participants
Corresponds to
Reported as
Role
Note

mir-7

bait
aop 

Yan

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Mutation of mir-7 leads to upregulation of aop protein.

Source was larval lymph glands of mutant fly line; bait produced from endogenous gene; prey produced from endogenous gene.

FBrf0214819-2.miR-mRNA.IHC
Description
physical association
Collection
Cell line used
Participants
Corresponds to
Reported as
Role
Note

mir-7

bait
aop 

Yan

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Overexpression of mir-7 leads to downregulation of aop protein.

Source was larval lymph glands of mutant fly line; bait produced from transgenic construct; prey produced from endogenous gene.

External Crossreferences and Linkouts ( 1 )
Linkouts
MIST - An integrated Molecular Interaction Database
References (2)