Open Close
General Information
Interaction Type
Interacting Genes
FlyBase ID
FBig0000105104
Interaction Network
Interactions Browser links
mir-7 network
E(spl)m5-HLH network
esyN Network Diagram
Show neighbor-neighbor interactions:
Select Layout:
Legend:
Protein
RNA
Selected Interactor(s)
Common Interactor(s)
Reported Interactions
FBrf0187594-4.miR-mRNA.GFP
Reference
Description
physical association
Collection
Cell line used
Participants
Corresponds to
Reported as
Role
Note

mir-7

bait

m5

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
3-prime UTR
sufficient binding region
mir-7 target site
necessary binding region
UCGACAUCGAAUCCAGUCUUCCAAUCGACAUUGAAUCCUGUCUUCCAUGCUGCAACGAAUCAUGUCUUCCA
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Source was larval wing discs of transgenic fly line; bait produced from transgenic construct; prey produced from transgenic reporter construct.

GFP reporter assay

FBrf0191474-1.miR-mRNA.LUC
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note

Mir-7

bait

m5

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
3-prime UTR
sufficient binding region
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Source was S2 cell line; bait produced from transfected construct; prey produced from transfected reporter construct.

Luciferase reporter assay.

External Crossreferences and Linkouts ( 1 )
Linkouts
MIST - An integrated Molecular Interaction Database
References (2)