Open Close
General Information
Interaction Type
Interacting Genes
FlyBase ID
FBig0000106230
Interaction Network
Interactions Browser links
mir-263b network
hid network
esyN Network Diagram
Show neighbor-neighbor interactions:
Select Layout:
Legend:
Protein
RNA
Selected Interactor(s)
Common Interactor(s)
Reported Interactions
FBrf0211074-2.miR-mRNA.LUC
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note

miR-263b

bait
hid 

hid

prey
hid 
hid 
hid 
hid 
hid 
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
hid 
3-prime UTR
sufficient binding region
hid 
mir-263b target site 1
necessary binding region
AGAAUUUUAUUUGGUGCCAAA
hid 
mir-263b target site 2
necessary binding region
AUUUUUGGUUUGCCAU
hid 
mir-263b target site 3
necessary binding region
UAGUUUUUAUGCCAU
hid 
mir-263b target site 4
necessary binding region
CGCAGUUCGAAUCACAGAAUCAAAUGCCAU
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Source was S2 cell line; bait produced from transfected construct; prey produced from transfected reporter construct.

Luciferase reporter assay.

mir-263b miRNA was transfected into S2 cells.

External Crossreferences and Linkouts ( 1 )
Linkouts
MIST - An integrated Molecular Interaction Database
References (1)