Open Close
General Information
Interaction Type
Interacting Genes
FlyBase ID
FBig0000107549
Interaction Network
Interactions Browser links
Hrb98DE network
shg network
esyN Network Diagram
Show neighbor-neighbor interactions:
Select Layout:
Legend:
Protein
RNA
Selected Interactor(s)
Common Interactor(s)
Reported Interactions
FBrf0217856-1.XL.TV
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note
shg 

shg synonym

bait

biotin label

shg 

Hrb98DE synonym

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
shg 
5-prime UTR
sufficient binding region
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Interaction in vitro; bait produced and labeled in vitro; prey derived from wild-type adult female ovary extract.

FBrf0217856-2.EMSA.TV
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note
shg 

shg

neutral component

biotin label

shg 

shg

neutral component

biotin label

shg 
shg 

shg

neutral component

biotin label

shg 

Hrb98DE

neutral component

Hrb98DE

neutral component

Hrb98DE

neutral component
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
shg 
5-prime UTR
sufficient binding region
CAGGGCGCGCACUGUACGAG
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Binding inhibited by poly(ADP-ribose).

Interaction in vitro; RNA produced and labeled in vitro; protein produced as a recombinant fusion protein in bacterial system.

FBrf0217856-3.coIP.PCR
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note

Hrb98DE

bait
shg 

shg

prey
shg 
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
shg 
5-prime UTR
sufficient binding region
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Source was cell extract of S2 cell line; bait produced from endogenous gene; prey produced from transfected construct.

FBrf0217856-4.coIP.PCR
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note

Hrb98DE

bait
shg 

shg

prey
shg 
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
shg 
5-prime UTR
sufficient binding region
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Source was ovaries of wild-type fly line; bait produced from endogenous gene; prey produced from endogenous gene.

FBrf0233508-1.coIP.PCR
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note

HRP38

bait
shg 

E-cadherin

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Source was adult female ovaries of wild-type fly line; bait produced from endogenous gene; prey produced from endogenous gene.

External Crossreferences and Linkouts ( 1 )
Linkouts
MIST - An integrated Molecular Interaction Database
References (2)