Open Close
General Information
Interaction Type
Interacting Genes
FlyBase ID
FBig0000111028
Interaction Network
Interactions Browser links
AGO2 network
hpRNA:CR46342 network
esyN Network Diagram
Show neighbor-neighbor interactions:
Select Layout:
Legend:
Protein
RNA
Selected Interactor(s)
Common Interactor(s)
Reported Interactions
FBrf0206362-35.coIP.PCR
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note
AGO2 

Ago2

bait

FLAG tag

esi-2.1

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Source was cell extract of S2 cell line; bait produced from transfected construct; prey produced from endogenous gene.

FBrf0207830-2.coIP.NB
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note
AGO2 

AGO2

bait

hp-CG4068B

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Source was cell extract of S2 cell line; bait produced from tagged transfected construct; prey produced from endogenous gene.

Positive control.

FBrf0210024-12a.coIP.NB
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note
AGO2 

AGO2

bait

esi-sl-1

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
esi-sl-1
sufficient binding region
UUGACUCCAACAAGUUCGCUCC
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Source was cell extract of S2 cell line; bait produced from endogenous gene; prey produced from endogenous gene.

FBrf0222990-11.coIP.NB
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note
AGO2 

AGO2

bait

FLAG tag

esi-2.1

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Source was cell extract of S2 cell line; bait produced from transfected construct; prey produced from endogenous gene.

Positive control.

FBrf0223644-1.coIP.NB
Reference
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note
AGO2 

AGO2

bait

FLAG tag

esi-2

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Source was adult male flies; bait produced from tagged transgenic construct; prey produced from endogenous gene.

FBrf0224072-5.coIP.NB
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note
AGO2 

AGO2

bait

FLAG tag

esi-2

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Source was cell extract of S2 cell line; bait produced from tagged transgenic construct; prey produced from endogenous gene.

FBrf0227265-3a.coIP.NB
Reference
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note
AGO2 

AGO2

bait

FLAG tag

hp-CG4068B

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

hpRNA:CR46342 hpRNA is preferentially associated with AGO2 over AGO1.

Source was cell extract of S2 cell line; bait produced from transfected construct; prey produced from transfected construct.

FBrf0228536-1.coIP.NB
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note
AGO2 

AGO2

bait

FLAG tag

esi-2

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Source was cell extract of S2 cell line; bait produced from transfected construct; prey produced from endogenous gene.

External Crossreferences and Linkouts ( 1 )
Linkouts
MIST - An integrated Molecular Interaction Database
References (8)