Open Close
Reference
Citation
Deak, P. (1999.12.22). P element flanking sequence data. 
FlyBase ID
FBrf0125057
Publication Type
Personal communication to FlyBase
Abstract
PubMed ID
PubMed Central ID
Text of Personal Communication
From: P. Deak.
Date: 1999.12.22
Subject: P element flanking sequence data
>l(3)S030003/86E14-20/Pharate adult lethal P-lacW insertion/BACR24C01
AATCGGGCCATGAATGACCGAAGCGATGCGTACAACAAAACCGATAGCCACAGTAGTAATTAAAGGCAATAACCGAAGCG
TGGCGCATCGTAGTTTTTGTTACGGGTTTCCGTTCATAGTAATGCCTTTTGTTGTTGCTGTCTTTCGGTCAGTTTCTGCG
TCGTCGGCAAAAATTTTCGGTCGCTGACGTCACACCTAGGCGCCACAAAGCTCCCCCCACTACCCACTGTCATCCCCCCC
TTCTCCCTCTCTCTCTCTCTCTCTCTCTCTCTCCGGGGTTCTATGTATCCCGTTTGTTTGTATATTGCAACATGCGTGGG
CGTTATACTCCAACTGTATCGGTGTGAGTGAGCAAGTTTGGCTGTGTGAGGTCAGTGTTGCGTTGAACTTTTCGCATTGG
AATGATGATGTACTAACTTTTGGCGCCCACTGTTCAATATTCCCTTTATTGCGCCTATTACGACTATCTATCTCTGCCCA
TTTTCACTTGCGCTAATTACGCCGTTGCATGAACACTGTACTCGGGACTGAATGGAATGTTAATTGGAATTTGCAATTTT
ATTTATCCGAATGGTCATAA
>l(3)S026316/87E1-2/BACR48D15/pic allele/L1 lethal P-lacW insertion
TCCTGGACAGTGTGCAGTCATGTCGCATCACTACGTGGTGACGGCGCAAAAGCCGACGGCCGTTGTTGCCTGCCTAACAG
GTAAGAACAAGAGAGCGTGTGAAAGAGAGGGGCTCCCTATGCGGTCTCCCCCGGCGAAAACAGAAAACAAGCATGTTTGC
CGGTCGCCGGATTACACAAGCCCATGAAACAGATTTGTTTGCTTAGCACCGGCTTCTTTGGTATGCTCCTCAGGCAACTT
CACCTCGCCCACGGATCTCAATTTGATCATTGCCCGGAACAATCAGGTGGAAATCGATCTGGTCACGCCGGAGGGGACTG
CGTCCCCTAAAAGAGATCAACATAAATGGCACCATTGCCGTGATGCGCCACTTCCGACCGCCCGACAGCAACAAGGATTT
GCTCTTCATACTGACGCGTCGTTACAACGTCATGATCCTCGAAGCCCCGTATGGTCAACGACGTCATCACGGTGGTTGAC
CAAGGCCAATGGTAATGTTTCCGACTCGGTGGGCATCCCCTCCGAAAGGAAGAATTATTGCGGCCATCGATCCCAAGGCT
AAGGTCCATC
>l(3)S061617/87E/BACR06H18/l(3)87Eg allele/L2 lethal P-lacW insertion
CGCTGACGAAAACTTCTAGAAACTGTGTGTATGTGTGCGTGCGAAAGAGAAGCGGTTGTTGTCGAAAGGGGGAAAGAGAG
CGTCAGCTGCTCGCCGTATTGAAATACGAAAATTGTTCTAGAAAATCGACTAGAAAACGTCGCAGTTATTTTCGCGAACA
CATGGCGGCGTAACGACCTTGAATCCCGGGCTCTAGCTTCCGGCAATGCCTACTATTTTCCGTTGCCCCCCAAATTACNC
GGAAAAAAATGGGTGATGGCATCAAGTCACAGCTGTAGAAATCAATAAACAAGAAAGGGTCATATGATCGAGTGGTTTCT
GGATTTTGAAAAATGTATTTCTACAAAAAAAAAATGGGTAACAAAATATAGGTTACTGATTTTTGTTTACAATACTAGTT
AGAGAGGAATCACCCTTTGAACTATGAAATGTCATTGGATGATGAAACTGAA
>l(3)S011004/87F/BACR30G22; BACR25B05/semilethal P-lacW insertion
GCGGGAGCGAGTGCAAAAGAGAACGATATACGGCAGGTGCGCTGCGCTCTTGATGGCACCATTCTCTTAGGCGAGTGGGT
GAGAGCGAGTGGGGAGATGATCACGATCGTATTTTCATTCATTTCCAGGTAGAGCATATCTCTCGCTTTCGCTCTCTCTC
TCTCTCTCCGCTCTCGCTCCCTCTCTCTCGCTCTGCTCACACCCACCTGGATTTCATTCACCAAACAGCTGTTTCTGATC
GAGTGGCCTCGTTCTGCTCACACGTGTGTGAGGATCTTGTGTGTATGTGTGCGTTGGAGGAGCTCAGGTAAGAACTATCC
TGGAATTCCGCGGAATTAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATA
ATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATT
CAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAAGTATGAGT
>l(3)S011046/86F/BACR03D22/CoVa allele/Prepupal lethal P-lacW insertion
GCACGCGTCAAGTTGAAGATGCAGTGTGACCGCAATTAAATCATCAAAAAATACCGCCTGGCAGTAGCCAGCATCAATGT
GGACCGTTGAAAAAGAAACAAGGTTTGATTTTGATTTTTTTTTTGCTTTTTTTGGGCAAGATAGAAGAAATTAAATATAA
GGAAAATGATAAACTAACTGTGATCTTACCCGAATTTGAAATATACTGAAGCAGAAACATTTTAAATATCTCACTGTTCC
GTGACAGCGACAGTTATAAACGTGTCCATCCCTGGAAAAGCCAGTGTTGCCAACCATCACTCAGATCTGTCATACCCGTG
TGAAAAGTAGCAAGAACAAGAAAAGTGAGTCGAGCTGTTACTTAACCAAATTTTTGCAATTAACAAGCATTTTACTGTTT
TTAACGGCAGCATGTTGAGCATCACGGCCCCGTAACCTGGGCAAGCGCCCTCCGCAAGCAGCCTCCGTTCGGCACATCGT
CCGCGCCGTTGGCCGCCCGTTGCGCTGTCTGCACGGAACCCGAAGAATCGGCGGAAGANTTCGACAAGCGCTACGAAAAA
TTACTTCACCCGTGAAGGCATCGATGGCTGGGAAGATCCGCAAGGGCATGAACGATCTGCTGGGCATGGATCTGGTGCCC
>l(3)S144201/86F4-9/EP(3)3738 allele/viable P-lacW insertion
CACTTGGCCATTTGTCTCTCCATTCTCCATTTTTCGCGCCTCGCTCTCAATTCTCTGCGCTCAAATCCTCTAGCAATTCT
AATTCGTATTCTCGCCGCCTCGCTTTGAACTTGAACTTTAAATGCACAAACCATAATCGTGTATGTTATGTTGTTGCTGG
CCGAGGGCGTGCTCTCGCACTCTGGCAAACATGGGCTCTACGAGTTTGCTATATATACGCAGCGCAATCAGTTGCGAGGC
AGCACTCGTTCCATTTGGGCGCTCGACAATCGCCCGCTGATCAGTTTTCGACTGGCTTGCAATTAATTCGGCTCTTGACG
AGCCCCAAAAGTGAAAGTCGCGAGTGAAAGACGTGGCAGTTTTATATTAAAGAAAAATACGAAAACGGGCAGCAGATCAA
ACATGAACAGTACGCAAAACACGAAATGCGAAACGGCGGCAACAAGTTAATAAATTAAGAAGGCAAACGAAAAAAATCCA
GATTCCGAGCACTGCAAAGAAATTGGCACAAATGCTTTGCTTTTATCCGTANGAAATTCGCAAAAAATGTACAAATAAAA
CGAAAAGAAAATTGCCACTATCAAATCCCACCGTTCTTTAACTATAGTTTCCTTCTAAATCTACCTCTAATAGGCTTTGT
CTGTGCATTCGAAAGCCGATCAGA
>l(3)S126113/94B5-10/BACR48C17/buttonless allele/semilethal P-lacW insertion
CACCTTATGTGACCTCATCATGGCCGCACATATTTGGGCGATATGTGGATGCCCAGTTATCGCAGATTTGTACTAAATGT
TTGTAAATTGTAAATTGTACTATTGCACTGGGGTTGGGAAGCATAAAAGTATTAATATATCGATAGATATCGGAAAAGTA
TTTCTACCGTTGCTTCATTTCTATCGATAGATATATTTAAACTTCTTGTATACTTATTCTAGATTAAATGACATTTATTA
GCTGACAAAGGAAAATAAAAAGAAATATATGAATAAATCTAGCCAAACAATAACTACACAGCGAAAGGAAAGC
>l(3)S054907/87A/BACR03D22/l(3)86Fg allele/Embryo lethal P-lacW insertion
CACCTTATGGGCCTTCATCATGAAGCTCGACTCACTTTTCTTGTTCTTGCTACTTTTCACACGGGTATGACAGATCTGAG
TGATGGTTGGCAACACTGGCTTTTCCAGGGATGGACACGTTTATAACTGTCGCTGTCACGGAACAGGGGAGATAT
>l(3)S097907/86E/EP(3)0430 allele/L3 lethal P-lacW insertion
TGCCAGGTTAAGATCAGCGCTCTTTGTGGGTGCTCTCCAATGCTCTTGGTGGGCTCTCCATTACACTAGACTCTTTGCCA
CTCTCTTTATATCGCTCTTTCATAGCACTACTCTCGATCTCTTTTGTTTGTGGGTTATTTGTTTAGTCTTTAGTGAGACT
ACTGATAACCAGGTTAACTCATATCTTCCTCGTTTCGCGCGACACTCTCGCAGTA
>l(3)S036916/86E10-13/BACR48M21/Human E2K homologue/Pharate adult lethal P-lacW
insertion
GGCGGACTGCAGAAAATCGACGTTGCTTTGCCTTGGCCGCTAACTCTGTTTTAAATTCGAGTGCTTTGACATAAATTGAA
AGTAGAACAACCGTCGAACAGAATTTCGCGGACCAGAGTCGCAGCAATGACGGGAATAATTTCGATCGTC
>l(3)S000512/87b3-5/BACR30N15/svp allele/Embryo lethal P-lacW insertion
GTCGAAACGGTCGAGTCGAGTCGGGTCGGGTCGTGTACCTTTTGCCACGAATGTTGTGCCAGTCAGGCTCTAAAAGGCCT
TACGAGAACAGCTGAGATTTCGCTGCTCCGCATGACGCAAAGATACCGAAATTGAAAAATTTTCAAGTCTTTAAGATATT
ATATCTCGTGTGTGCGCCGAGCGGGAAATTAATAAGCAACATCGGAAAAATTCAAAAATTCAAAAATAAACCAAGTGTTT
TATTAGTGAAGCCAGCTGAAATGTTAACAGCATATGCAGCTTAAAAGAAAATATTAAATTTATTTTAACATAAAGAAGAA
GAATTATAACGCGGCTGACAAATACGAATAAAAGGATACAAGTTAAAAGCTAGAGCCGAGGACTCTATCGAAACCAAAGT
>l(3)S028813/87b10-15/BACR28I14/semilethal P-lacW insertion
TATTGAAGCCACGAGAAACGAAAACCGGTAAAAACCGACCAGAGGCCACCAAAAGACAGCAAACATTCGAATACAAAGTC
AGCAAACATTGACCATTTATCAGAGGCACGCATTGAACTTGAAATTTGCCGCTGCTTTTGCCAATTTCTTGCGCGAAGGG
AATGGACATCGTGGGAGCTTACACAAGAGCGAACGAGAGCGATAGTAAGCGCTAAGAGCAAGATGGAACGAGAGTAGTTT
TAATTTCGTTATTGTTGTGGTCCGTTATCACGTTGCAAGAAGCGTGATGCTTCACTAAGATATTACACGCTGAGAAAACT
GGAGCGCGTTCTTAAAGTTCANATGAACTGAATGATCTGTAATTTAAACAAAACTAATAGAACTGCTATATTCAAAATTC
GGAATGTAAATAAAAGATTCTTCTGTCTTTAA
>l(3)S120813/87C1-3/BACR07J06/Vha55 allele/L2 lethal P-lacW insertion
ACACTTATGGGCCTCATCATGGTTCCAGGGCAATTTTTCATCGTACTCGCAACGACTTCGCAGGCCAAAATTTTGCGTGT
GTGTCGCTCAGTACTGTTTCGTAGCTGAAAAATTGTACGTGCTTGTAAAAGACCACGTCCGAATAGTGGCTAAAAGCTAA
AATCGTATCTAATTGCAGTTCGAAATTTGCAGTGCACTTTCAAGGTAGAGGCGCAGAAAAAGTCTATCCAAGATGAACGC
CCAACAAGCCCAGCGGGAACATGT
>l(3)S146507/87C/BACR07J06/l(3)05043 allele/Pupal lethal P-lacW insertion
ACACTTATGTGACCGCACCATGCTTCAATTCGTTGCCCGGCTTGTAAGTCAATGCTAGTGTGATAGTAGTCTTCGGAAAA
TCCGCAAAGTATTTTTTTTTAGTATTTTTTTAATTCGAATTCATGAAACAAGAAAATTTGTTAAAAAAACGCTAACACCA
ACATTTTCGGAAAATGTA
>l(3)S074205/87C/BACR07J06/nucleoporin (nup) gene/semilethal P-lacW insertion
AAGCCGGGCAACGAATTGAAGCATAAACAAACGATGTCGCTCACCGATGTCTTGGAATTGAACAAAACGGAGTTGTTCGC
GAAGATTCGCAATGGGTTGCCCGTGGTGCAAAGGACTCAGAACCTGCTGGACTGCAAGGACGATCTGCTCTTTGCCTGGC
ACGCGAAGGACAGCTGTCTGTTGGTTCGCAACTGGCGCTCATCGCTGGCGGCAAAGGTGAATATCCAGTTCCAGACACTG
ATTCCATCGAGCTTGGTGAGCCTGGAGGTGGACCGCGTGCTGGCCTCCAACGAAGGCTCCCTCGTGGCACTAATGGACCG
CCGGCTTGTTCATAATGGAACTTGCCCCGCCGCTGGGGCCCCATTGG
>l(3)S029910/87F/BACR03J04/Pupal lethal P-lacW insertion
GTTTACGCAATCAGCTGCGAAAAAACACGAGAATGCTCATGTGTACATAAGTGTGTCCAAGTGCCGCACAGCGCCACAGA
TTTCGTTTATTATTAATTTTTATGAATAACCAGCGGCCGCAGAAGGTGGC
>l(3)S101804/87E8-12/L2 lethal P-lacW insertion
CTCTCGACTTTCTCTCACCGCTCTCTTTGGCGGTCTCTTCTTGCGCAGCAGCACCAGCAGTTAACGGTGCATGTTGAAAA
GTTCTCACACAAACGTCGTGAAAATCGAAATCGATAAGTAAGCAACGAATTTTAGCTGCCCAGAAAAAGACCACAAATTT
CAGTGAAAACCCAGCGATAAGAATCCCAAAAAGTACTAATCCAGCTGAAAAACAACCATCTTAACCGGCCATGTCCAAAA
AAAGTGTTAGCCAAGTGTTTTGAATAACGTAGTTGGTGTAAATGCTTAAAAAAAATAAGCTAGTCCGGGGCCAGAGAAAT
CGATACGATACCCCCAAAAAAAGGGGGGCTGCTGCGTGGGCTGCCCGAGTTGAAAATTTCCAGCTAAAAATAGTACTAGA
TTTGAGCTTGAAGAAAACCCTTGATTTCCTTTGCGTTTCGATGTCAGTTATCATTGCATTTCAGTTACATAATTTTTGAG
>l(3)S104101/87F1-8/BACR03J04/EP(3)3732 allele/Embryo lethal P-lacW insertion
GTCTGACCCCTTTTGTGTTCTCTCTCGCTTGCGCTCGTGCGTCGGAGTGTGTTTAAGTGTGTGTGTGTGAGGTGTCGGTG
CGACTGTACTTCAGTCATATTAATAGAATCTTCGGGCCAAAATGCATCATCACAGTCTCGGGAGACATGGAAAATTTTCA
ACGTTTTCCCCTGCACACACAAGCACTTTCCGCAATGAAAACCACACTCCACTTAACCTACCGACCCACACATTCTCCCC
CTCTCGCAA
>l(3)S008131/87E5-10/l(3)05137 allele/semilethal P-lacW insertion
CGGTACACCCATTGAAGTCGAGCGTCAACATTAAACAACTGGTACTGGTGAAGAGCTTTTTATTGACAACGCAATCACTC
ACCAAACTTTGTATGTGACTGTGTGTATGTGAGTGGTGATGGTGGTGCTGATGGTATCTATTGGCATAAGAAATTATAAC
ACTCGGGAATTACGGTGTAATTGTGAGCTTTGCTAATATCTGGTATCCATTCAATGGCGCATTTCCCATATGGTCATGGG
GTAATAGTCATGAAAATGCCATGTGCAAATGACTCAAATTTTCCATTCAGAAAACATTTATGTAATTTCAAGAAAATCCG
GGCGTGCGTCTGCCGAGACCCATTAATCATTGTACCCTAATTAACGAAACATTATTATTTTGTGCCTAATTAAATCGATT
GCGTTGTGTTAATGCACTTTTAAGTCAAGGTTTAATTAGAATGTTTTTGTTTGCCTGCACTTTGAGTAATTAACGCTTCG
AAACGGAAAATCTGTTGCCTAAACGGTAACTTAGCCCGTGATAAGAATCCATAGCGAAGAATGAATGCGCCAATATTTCT
CCCACTTGTATTACCATAATGCCTAATCCTAATTAAATATTTCTCGCACTTTTCCGTGCATGTCCCACCATAACACAATT
GTTC
>l(3)S076201/86E9-12/EP(3)0430 allele/viable P-lacW insertion
GGACCACCTTATGTTATTTCATCATGGTCCGACTCGTTCTGACCCGATCCGCTCTCGGGCTCCACCTTAAATACATGTCA
CTCTCTGGGTAGGTGTTGTGCCAGGTTAAGATCAGCGCTCTTTGTGGGTGCTCTCCAATGCTCTTGGTGGGCTCTCCATT
ACACTAGACTCTTTGCCACTCTCTTTATATCGCTCTTTCATAGCACTACTCTCGATCTCTTTTGTTTGTGGGTTATTTGT
TTAAGTCTTTAGTGAGACTAGTGATAAGCAGGTTAACTTATATTTCCCTCGTTTNGCGCAACACTTGCATAATTAACCAA
CGTGTTAACAAT
>l(3)S049215/86F/Dm2615/viable P-lacW insertion
CACTATACTATACAACATTTACAATGTGGCTACACATACGGACAGACAATCGCCTGCAATGCACATGCAGGCACATGTGT
CTGTATAACATAATCACTAAAAATTTATTTTATTTTTATCGATTTATTTTCGCCCGCTGCGGGCAGCGTCGCCGGCGTCA
AAGCGTCAGGGGGTATACACTCTCACTCGAGCAGCGTCAGTGGCGGTGGTGGT
>l(3)S050116/86F/BACR11G22/EP(3)3094 allele/viable P-lacW insertion
GGCCACACGGATGAAATTCGTCGTCATTCGTCGGAATCATTCGAACTTTGAAAATGGATCGGTAGCTGGGAAGGAAACTT
AAAGCGAAATACGCAAAGAAAACGGCTTTTGTCCGCTATTCAGCGATTTTTTTTGTGTTGTAATCAGCAGAGGAAATTTT
AACGACCAACTCCACCGCCACACCAGCCATCTCCAGCAGCCCCGGAAAATAAAATAGAACTAAATTAACGCCACCATCAC
TACAACAACCATCTCACCAACAACTACAAGAGCAACAACCACAGCAACAGCACTACTGCACCAAGCCCACAAAAAAAAAG
TTGAAAACGCAATAATCGCAATACCCAAAGAAAAAAAACAAAAAAAT
>l(3)S051601/87C1-3/BACR02G11/Alpha-gamma sequence/viable P-lacW insertion
ACATCTACTTCCCCCCCGCTCCTACCCGCGACCAGACTACGTTCGGCAGAAAACTCTAACGGTTGTCTGCCGCGCATCAG
AAAAATAAAAAGAGGCGTCTGCATGGCGCGTGCCAAGCAGAAACACGAAATTTCGTTTCATTTAAATGATCTGCGACATA
TACATACATATTACATACATATTTTCAACACTCCTTCTCAATGCAATATGTCAACCCTTACGGATAATATTTTTATCTTA
ATTCCAAAATCAAAATACATTTTTGTTATTTTAAACCCATCCCTTGGATACACTTTTCATGTTTAAATCTATTCAAATTC
TTGGTTAGAAACATCTGCCATCATGTTTTCTGTGGGTACATAATTAACTTCTATTATATTGTTCTTATACAATTCTCTTA
TATAATGATATTTTATATCTATATGCTTACTACGTGCATGGAAAGTTTAATTTTTCACCAAGCACTGGGAACTCTGGTTG
TCGCTATAAACCTTAATTGCCTGTGTTTCACCAAAACCATTTCGTTGAACAATTTCCGAAACATACCCACTTCCTTCGCT
GCCATGGAAAATGCCACATACTCTGA
>l(3)S108408/100E/BACR48C22/awd allele/viable P-lacW insertion
CTCCTGATGCTCGGCACAATTTTGGCATTCTTTTCTGTAATCTCGGCGACAATGGCGGCTAACAAGGAAGAGGACTTTCA
TCATGGTCAAGCCCGATGGCGTCCAGCGCGGGCTCGTCGGCAAGATCATCGAGCGCTTCGAGCAGAAGGGCTTCAAGCTG
GTCGCCCTGAAGTTCACCTGGGTAAGCGGGATAATTGAATTAGGAAAGAAAATCAATAGATATAAATACTGGGAAACGGG
TTGGCCCCACCGGGGGTT
>l(3)S125006/87D1-5/BACR14H21/viable P-lacW insertion
GGTGAGTGCTATTTTAAGCACCCAAGATAATTGCAACAATAAAGCAAAATAGATCACTTTTGCATACGCGCGACACAACC
GATCTCTATGAATGCAGATTTGCGACTTCTCCAATTTCACTAGTTTAGAAACTGTGCTCGTTTCAACAAAATTGAAAAAG
GCAAGAGTGCAATTGCAGCAGCAGGTGAGGAAGTAAGCAGCCCCCAAGGACTCACCTTAAATACCTAGAAGCGACTTTGA
AAAACTTCATTAAGGATACATCGACAGTGCACAGTAATAAGGATTGTAATAAACTAATCTGTTGACAATGTTCCGCCTTT
GTCTGTCCAAGTACAGATAATATCATGCACTTATGCAGCTTAATGGTCTTTT
>l(3)S011041/87F10-15/BACR30G22/EP(3)3183 allele/viable P-lacW insertion
GCGGGATCGAGGTGCAAAAGAGATACGAGTATACGGCAGGTGCGCTGCGCTCTTGATTGGCACCATTCTCTTAGGCGATG
TGGGTGAGATGCGATGTGGGGAGAATGATCACGATCGT
>l(3)S130313/87F1-3/BACR06H18/viable P-lacW insertion
CGTCAAGCTCTCTACAACAATCAACAGTTCGCGCTCAGCCACCGAAACCGCTAACAACACGACCGCCGTTCGTTACGTGC
TGGCTATATAACTGCATTTATAAGAAAATTCTGAAGAACGAGAAGCCTGAAGATGAGTCACAAAATCGCCGCTGTGTGCC
TCTTGATGAGCTGCCTGATTGCCACGGCTTATAGCGCCGCTAAGGTGAGTTTCCGGCTCGGAAAAACCCTTCGCCAAACT
AGCGAAAAATCAGCCAACGGGCCCAACTAAGCCATTACACAACAGCCAAACGTGTCAGGGGCACTCCGAAATTGCTTTTA
CCATTTAGGTGAANACGTGATTAAGTCGAATAACTAAATATGGGGGTTAGGAAAA
>l(3)S025616/87D6-14/BACR14H21/CtBP allele/viable P-lacW insertion
TGAACACCTTATGTGCCCCACCATGACTAAAACCTAAAAATCCGCCGTGTTCGTATTCCGCCATTTTGAAAGCTGCGAAG
TGGAATTTGGACGCGTTGCTGGTAAATTAATTGTGGGAAAACTGCCCAAAAAGTGCATAAAATTTGTGAAAAGTGGTCGG
CAACGGTGCATGAGACCCGCCGCCAAGTGTTTGTCCCCGAAAATTGTGTGTGGCCGCGTTTTTGGCACGTGAATTTCTTG
CCCAATTGTGAACTCGCCCAAAAAGAA
>l(3)S022122/87D9-14/BACR14H21/EP(3)3352 allele/viable P-lacW insertion
GTACAGCAATGACGCTATGCGAACAGTGTGACCGCACACGGGTCGTTCGAAAATACCTCGGTGCGCGCAGACAAACTGCA
AGAAATTATGGTATAGTTTGAAATGTTGGTATTGCAGAATTCCGCGGAATTAATTCTTGAAGACGAAAGGGCCTCGTGAT
ACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCG
GAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAAACAATAACCCTGATAAATGCTCCAT
TATTTT
DOI
Associated Information
Comments
Associated Files
Other Information
Secondary IDs
    Language of Publication
    English
    Additional Languages of Abstract
    Parent Publication
    Publication Type
    Abbreviation
    Title
    ISBN/ISSN
    Data From Reference