Home
Reference Report
| Reference | |||
|---|---|---|---|
| Citation | Mount, S. (2000.5.30). snRNA report - some questions. (Export to RIS) | ||
| FlyBase ID | FBrf0128767 | ||
| Publication Type | Personal communication to FlyBase | ||
| PubMed ID | |||
| PubMed Abstract | |||
| Text of Personal Communication |
>From smount@XXXXXXXXXXXXXXX Tue May 30 03:52:01 2000
Envelope-to: ma11@XXXXXXXXXXXXXXX Delivery-date: Tue, 30 May 2000 03:52:01 +0100 X-Authentication-Warning: rac5.wam.umd.edu: smount owned process doing -bs Date: Mon, 29 May 2000 22:57:23 -0400 (EDT) From: Stephen M Mount <smount@XXXXXXXXXXXXXXX> To: Michael Ashburner <ma11@XXXXXXXXXXXXXXX> Subject: Re: snRNA report - some questions MIME-Version: 1.0 Michael, Sorry to be so slow in responding. I think that I explained the basis of my naming and addressed all of the U-RNAs last time. The questions I did not address are below:> 7. I think I asked you this before: Any idea what these are ? >> \*a snRNA-a > \*z FBgn0003454 > \*x FBrf0042443 == Arrigo et al., 1985, EMBO J. 4: 399--406 > \*g M26817 AE003241 446-506 is a pretty good match. This same sequence is in>gb|M21017.1|DRORGAB D.melanogaster 18S, 5.8S 2S and 28S rRNA genes, complete, and 18S rRNA gene, 5' end, clone pDm238. This is 95% identical to the 5' end of 18S rRNA. > \# > \*a snRNA-b > \*z FBgn0003455 > \*x FBrf0042443 == Arrigo et al., 1985, EMBO J. 4: 399--406 > \*g M26818 > \# This sequence is not in the genome, but it is somewhat similar to U6 (82%). Could it just be U6 sequenced badly? E = 0.05. It is not supposed to be in the cytoplasm (except transiently).> \*a snRNA-c > \*z FBgn0003456 > \*x FBrf0042443 == Arrigo et al., 1985, EMBO J. 4: 399--406 > \*g M26819 > \# This is not in the Celera genome, either, and doesn't resemble anything enough for comment.> \*a snRNA-d > \*z FBgn0003457 > \*x FBrf0042443 == Arrigo et al., 1985, EMBO J. 4: 399--406 > \*g M26820 > \# This is 90% identical to a piece of the mitochondrial genome,>gb|U37541.1|DMU37541 Query: 2 aaattttatatttaaattattatataaaaatgtaactcgagat-aaaaaactt 53 ||||||||||||||||||||||||||||||||||| | ||| | |||||| || Sbjct: 14648 aaattttatatttaaattattatataaaaatgtaatt-gaggttaaaaaattt 14597 ------------- The RNAs in this Wooley paper were not characterized sufficiently for positive identification. The only one in GenBank is K5, which is U1 (with two mistakes in 131 nucleotides, which is not bad for that methodology).> \*a snRNA:K2a > \*z FBgn0016982 > \*x FBrf0038653 == gm626.h == Wooley et al., 1982, Proc. Natl. Acad. Sci. USA 79(22): 6762--6766 > \# > \*a snRNA:K2b > \*z FBgn0016981 > \*x FBrf0038653 == gm626.h == Wooley et al., 1982, Proc. Natl. Acad. Sci. USA 79(22): 6762--6766 > \# > \*a snRNA:K8 > \*z FBgn0016980 > \*x FBrf0038653 == gm626.h == Wooley et al., 1982, Proc. Natl. Acad. Sci. USA 79(22): 6762--6766 > \# > \*a snRNA:K9 > \*z FBgn0016979 > \*x FBrf0038653 == gm626.h == Wooley et al., 1982, Proc. Natl. Acad. > Sci. USA 79(22): 6762--6766 > \# > Stephen M. Mount Cell Biology and Molecular Genetics H. J. Patterson Hall University of Maryland College Park, MD 20742-5815 Phone 301-405-6934 FAX 301-314-9081 permanent email address sm193@XXXXXXXXXXXXXXX |
||
| DOI | |||
| Related Publication(s) | |||
Recent Updates
|
|||
| Description |
What does this section display?
This section contains items that were added to this record for each release.
It currently only tracks new links between this FlyBase report and other
FlyBase data classes (e.g. genes, references, stocks) or controlled
vocabulary terms (e.g. GO, anatomy terms).
What does this section not display?
This section does not currently display links that were removed or gene model changes.
|
||
| Update Feed |
Click the icon below to subscribe to this FlyBase record and receive updates automatically through your
feed reader.
|
||
| FB2013_03 | |||
| FB2013_02 | |||
| All updates | Click here to see a list of all updates to this record from FB2010_08 and on. | ||
|
Associated Information
|
|||
| Comments | |||
| Associated Files | |||
|
Other Information
|
|||
| Secondary IDs | |||
| Language of Publication | English | ||
| Additional Languages of Abstract | |||
| Also Published As | |||
|
Parent Publication
|
|||
| Publication Type | |||
| Abbreviation | |||
| Title | |||
| ISBN/ISSN | |||
|
Data from Reference
|
|||
| Genes (10)
|
|||