Home
Reference Report
| Reference | |||
|---|---|---|---|
| Citation | Robertson, H. (2000.8.17). FlyBase error report for CG13873 on Thu Aug 17 12:26:18 2000. (Export to RIS) | ||
| FlyBase ID | FBrf0131083 | ||
| Publication Type | Personal communication to FlyBase | ||
| PubMed ID | |||
| PubMed Abstract | |||
| Text of Personal Communication |
From FlyBase-error@XXXXXXXXXXXXXXX Thu Aug 17 20:20:08 2000
Envelope-to: gm119@XXXXXXXXXXXXXXX Delivery-date: Thu, 17 Aug 2000 20:20:08 \+0100 From: FlyBase-error@XXXXXXXXXXXXXXX Date: Thu, 17 Aug 2000 12:26:18 \-0700 (PDT) X-Authentication-Warning: hedgehog.lbl.gov: web set sender to FlyBase-error using \-f To: flybase-updates@XXXXXXXXXXXXXXX Cc: hughrobe@XXXXXXXXXXXXXXX Subject: FlyBase error report for CG13873 on Thu Aug 17 12:26:18 2000 Content-Length: 788 Error report from Hugh Robertson (hughrobe@XXXXXXXXXXXXXXX) Gene or accession: CG13873 Gene annotation error Gene CG13873 has incorrect exon/intron structure. Comments: This member of the odorant binding protein family needs a nearby 5' exon to encode a suitable signal sequence. My coding cDNA is ATGAGGGCTACATTCGCATTGACTCTGTTGCTCGGCTGCCTTTCAGGAATTTTGGCGCAAGCCAACATAGACAGTTCGGT GTCCAAGGAACTGGTGACGGATTGCCTCAAGGAGAACGGTGTCACTCCCCAGGATCTGGCTGACTTGCAATCGGGCAAGG TGAAGGCCGAGGATGCCAAGGACAATGTGAAGTGCTCCTCACAGTGCATTCTGGTCAAGAGCGGTTTCATGGACTCCACT GGCAAACTGCTGACCGACAAGATTAAGTCTTACTATGCGAACTCGAACTTTAAGGATGTCATCGAAAAGGATTTGGACAG GTGCAGCGCGGTCAAGGGGGCCAATGCCTGTGACACTGCCTTCAAGATATTATCCTGCTTCCAGGCAGCCAATTAG Browser: Mozilla/4.7 (Macintosh; U; PPC) Accessed from: query.pl, /www/hedgehog_8000/htdocs |
||
| DOI | |||
| Related Publication(s) | |||
Recent Updates
|
|||
| Description |
What does this section display?
This section contains items that were added to this record for each release.
It currently only tracks new links between this FlyBase report and other
FlyBase data classes (e.g. genes, references, stocks) or controlled
vocabulary terms (e.g. GO, anatomy terms).
What does this section not display?
This section does not currently display links that were removed or gene model changes.
|
||
| Update Feed |
Click the icon below to subscribe to this FlyBase record and receive updates automatically through your
feed reader.
|
||
| FB2013_03 | |||
| FB2013_02 | |||
| All updates | Click here to see a list of all updates to this record from FB2010_08 and on. | ||
|
Associated Information
|
|||
| Comments | |||
| Associated Files | |||
|
Other Information
|
|||
| Secondary IDs | |||
| Language of Publication | English | ||
| Additional Languages of Abstract | |||
| Also Published As | |||
|
Parent Publication
|
|||
| Publication Type | |||
| Abbreviation | |||
| Title | |||
| ISBN/ISSN | |||
|
Data from Reference
|
|||
| Genes (1)
|
|||