Open Close
Reference
Citation
Butler, H. (2000.11.13). New genes. 
FlyBase ID
FBrf0132133
Publication Type
Personal communication to FlyBase
Abstract
PubMed ID
PubMed Central ID
Text of Personal Communication
From hb246@XXXX Mon Nov 13  14:07:05  2000
Envelope-to: gm119@XXXX
Delivery-date: Mon, 13 Nov 2000  14:07:05  \+0000
To: hb246XXXX, gm119XXXX
Subject: Re: newgenes
X-Sun-Charset: US-ASCII
From: Heather Butler <hb246@XXXX>
Date: Mon, 13 Nov 2000  14:08:16  \+0000
Content-Length: 12687
Hello,
All can be matched to CGs (and their translations match too...at least
to degree (I checked on exon of each)).
Lovely!
H
\*a AC014407
17(7): 1061--1074
Note:
This gene is a predicted cyclin-dependent kinase. They give the coordinates
of the gene relative to AC014407 (Celera draft sequence): exons are
at 22352-22122, 22098-21714, 21651-21501 and 21448-21277. They refer
to the gene throughout the text as 'AC014407'. gm000821.
>
\*a CG6800
Biol. Evol. 17(7): 1061--1074
\*F cyclin-dependent protein kinase ; GO:0004693 | inferred from sequence
similarity
\*d protein phosphorylation ; GO:0006468 | inferred from sequence similarity
21448-21277
\-----------
>CG6800|FBgn0038902|CT21089|FBan0006800  last_updated:000321 
Length = 909
Minus Strand HSPs:
Score = 860 (129.0 bits), Expect = 2.5e-33, P = 2.5e-33
Identities = 172/172 (100%), Positives = 172/172 (100%), Strand = Minus / Plus
Query: 172 GTTTCCCAACTCCGTGGGCATTCACTGGGACAACTTGTTTCCCAGCTGCACACATGCGGT 113
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 738 GTTTCCCAACTCCGTGGGCATTCACTGGGACAACTTGTTTCCCAGCTGCACACATGCGGT 797
Query: 112 GGAAATCAATCTGGTCTCGAATCTGGTGGTCTACAATCCCAAAAACCGACTCAAGGCCAG 53
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 798 GGAAATCAATCTGGTCTCGAATCTGGTGGTCTACAATCCCAAAAACCGACTCAAGGCCAG 857
Query: 52 CGAGGTGGGTTCTGCTTCAAGTTTGACACCGGTTAGGTATTATAATTGGTAA 1
||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 858 CGAGGTGGGTTCTGCTTCAAGTTTGACACCGGTTAGGTATTATAATTGGTAA 909
22352-22122
\-----------
>CG6800|FBgn0038902|CT21089|FBan0006800  last_updated:000321 
Length = 909
Minus Strand HSPs:
Score = 1021 (153.2 bits), Expect = 1.3e-40, P = 1.3e-40
Identities = 215/227 (94%), Positives = 215/227 (94%), Strand = Minus / Plus
Query: 231 ATGGAGGACTATGCGCCCAGCCGCTATAAAATGCTTGAGAAAATCGGCGAAGGCGTCCAT 172
ATGGAGGACTATGCGCCCAGCCGCTATAAAATGCTTGAGAAAATCGGCGAAGGCGTCCAT
Sbjct: 1 ATGGAGGACTATGCGCCCAGCCGCTATAAAATGCTTGAGAAAATCGGCGAAGGCGTCCAT 60
Query: 171 GGCTGCGTGTTTAAGGCCATCGATCTGCAGCGCAACAAGGAGGTGGCCATCAAGAAGGTG 112
GGCTGCGTGTTTAAGGCCATCGATCTGCAGCGCAACAAGGAGGTGGCCATCAAGAAGGTG
Sbjct: 61 GGCTGCGTGTTTAAGGCCATCGATCTGCAGCGCAACAAGGAGGTGGCCATCAAGAAGGTG 120
Query: 111 GCCCTTAAGAACAAGTTCGGAAACATAGCCCTAAATACTTTGAGGGAAATCAAGACCCTG 52
GCCCTTAAGAACAAGTTCGGAAACATAGCCCTAAATACTTTGAGGGAAATCAAGACCCTG
Sbjct: 121 GCCCTTAAGAACAAGTTCGGAAACATAGCCCTAAATACTTTGAGGGAAATCAAGACCCTG 180
Query: 51 CAGCTTTGCAAGTCTGAATATGTAG-GTATACCATATATCTATTTTC 6
CAGCTTTGCAAGTCTGAATAT T G A A CAT AT TAT T C
Sbjct: 181 CAGCTTTGCAAGTCTGAATATATTCTGGACATCATTGATATATATCC 227
\#
\*a AC017581
17(7): 1061--1074
Note:
This gene is a predicted cyclin-dependent kinase. They give the coordinates
of the gene relative to AC017581 (Celera draft sequence): exons are
at 96285-96040, 95976-95588 and 95296-94819. They refer to the gene
throughout the text as 'AC017581'. gm000821.
>
\*a CG7597
Biol. Evol. 17(7): 1061--1074
\*F cyclin-dependent protein kinase ; GO:0004693 | inferred from sequence
similarity
\*d protein phosphorylation ; GO:0006468 | inferred from sequence similarity
95296-94819
\-----------
>CG7597|FBgn0037093|CT23101|FBan0007597  last_updated:000321 
Length = 3644
Minus Strand HSPs:
Score = 2370 (355.6 bits), Expect = 3.9e-102, P = 3.9e-102
Identities = 474/474 (100%), Positives = 474/474 (100%), Strand = Minus / Plus
Query: 478 GGGTAAAGTAAAACTAGCTGACTTTGGGCTGGCACGACTATACAATGCGGACGATCGGGA 419
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3011 GGGTAAAGTAAAACTAGCTGACTTTGGGCTGGCACGACTATACAATGCGGACGATCGGGA 3070
Query: 418 ACGCCCCTACACGAACAAAGTAATTACCTTGTGGTATCGTCCTCCTGAGCTTTTGCTGGG 359
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3071 ACGCCCCTACACGAACAAAGTAATTACCTTGTGGTATCGTCCTCCTGAGCTTTTGCTGGG 3130
Query: 358 TGAGGAGCGTTACGGCCCGTCGATAGACGTGTGGTCCTGCGGGTGCATCCTCGGCGAACT 299
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3131 TGAGGAGCGTTACGGCCCGTCGATAGACGTGTGGTCCTGCGGGTGCATCCTCGGCGAACT 3190
Query: 298 CTTTGTGAAGCGGCCCCTGTTCCAGGCTAATGCGGAAATGGCGCAGCTTGAAACGATATC 239
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3191 CTTTGTGAAGCGGCCCCTGTTCCAGGCTAATGCGGAAATGGCGCAGCTTGAAACGATATC 3250
Query: 238 AAAGATCTGTGGATCCCCGGTTCCTGCCGTGTGGCCGAATGTAATTAAGCTGCCTCTGTT 179
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3251 AAAGATCTGTGGATCCCCGGTTCCTGCCGTGTGGCCGAATGTAATTAAGCTGCCTCTGTT 3310
Query: 178 CCACACTCTCAAACAAAAGAAGACGCACCGCCGCCGTCTACGAGAAGACTTTGAATTCAT 119
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3311 CCACACTCTCAAACAAAAGAAGACGCACCGCCGCCGTCTACGAGAAGACTTTGAATTCAT 3370
Query: 118 GCCAGCCCCTGCACTTGATCTGCTGGACAAAATGCTTGATTTAGATCCGGACAAGCGCAT 59
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3371 GCCAGCCCCTGCACTTGATCTGCTGGACAAAATGCTTGATTTAGATCCGGACAAGCGCAT 3430
Query: 58 CACAGCAGAAGACGCGCTCCGGTCACCGTGGCTAAGGAAAATCAACCCCGACGA 5
||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3431 CACAGCAGAAGACGCGCTCCGGTCACCGTGGCTAAGGAAAATCAACCCCGACGA 3484
95976-95588
\-----------
>CG7597|FBgn0037093|CT23101|FBan0007597  last_updated:000321 
Length = 3644
Minus Strand HSPs:
Score = 1945 (291.8 bits), Expect = 2.5e-82, P = 2.5e-82
Identities = 389/389 (100%), Positives = 389/389 (100%), Strand = Minus / Plus
Query: 389 GTTTACAAGGCGCGGGATCATCATACCAATGACATGGTAGCACTGAAGAAGGTTCGGCTG 330
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2622 GTTTACAAGGCGCGGGATCATCATACCAATGACATGGTAGCACTGAAGAAGGTTCGGCTG 2681
Query: 329 GAGCACGAGAAGGAGGGCTTTCCCATTACAGCTGTTCGTGAAATCAAAATTCTGAGACAA 270
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2682 GAGCACGAGAAGGAGGGCTTTCCCATTACAGCTGTTCGTGAAATCAAAATTCTGAGACAA 2741
Query: 269 CTTAACCATCGCAATATAGTCAACCTGCATGAAATTGTGACGGACAAGCAGGATGCTGTG 210
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2742 CTTAACCATCGCAATATAGTCAACCTGCATGAAATTGTGACGGACAAGCAGGATGCTGTG 2801
Query: 209 GAGTTCCGTAAAGACAAGGGATCCTTCTACTTGGTGTTTGAGTACATGGATCACGACTTG 150
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2802 GAGTTCCGTAAAGACAAGGGATCCTTCTACTTGGTGTTTGAGTACATGGATCACGACTTG 2861
Query: 149 ATGGGTCTGCTGGAGTCTGGCATGGTCGACTTCAACGAGGAAAACAACGCAAGCATTATG 90
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2862 ATGGGTCTGCTGGAGTCTGGCATGGTCGACTTCAACGAGGAAAACAACGCAAGCATTATG 2921
Query: 89 AAGCAGCTCTTGGACGGCCTCAACTACTGCCACAAAAAGAATTTTCTGCATCGAGACATC 30
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2922 AAGCAGCTCTTGGACGGCCTCAACTACTGCCACAAAAAGAATTTTCTGCATCGAGACATC 2981
Query: 29 AAGTGCTCGAACATTTTAATGAACAACAG 1
|||||||||||||||||||||||||||||
Sbjct: 2982 AAGTGCTCGAACATTTTAATGAACAACAG 3010
\#
\*a AC018104
17(7): 1061--1074
Note:
This gene is a predicted cyclin-dependent kinase. They give the coordinates
of the gene relative to AC018104 (Celera draft sequence): exons are
at 100085-99918 and 99860-98946. They refer to the gene throughout
the text as 'AC018104'. gm000821.
>
\*a CG7236
Biol. Evol. 17(7): 1061--1074
\*F cyclin-dependent protein kinase ; GO:0004693 | inferred from sequence
similarity
\*d protein phosphorylation ; GO:0006468 | inferred from sequence similarity
99860-98946
\-----------
>CG7236|FBgn0031730|CT22313|FBan0007236  last_updated:000321 
Length = 1179
Minus Strand HSPs:
Score = 4365 (654.9 bits), Expect = 9.5e-192, P = 9.5e-192
Identities = 873/873 (100%), Positives = 873/873 (100%), Strand = Minus / Plus
Query: 915 AACCTGAAGCATCCGAACCTTGTCTCCCTGCTAGAAGTGTTCCGACGGAAGCGACGCCTC 856
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 169 AACCTGAAGCATCCGAACCTTGTCTCCCTGCTAGAAGTGTTCCGACGGAAGCGACGCCTC 228
Query: 855 CATCTGGTCTTCGAGTTCTGCGAGCTGACCGTGCTGCACGAACTGGAGCGGCATCCACAG 796
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 229 CATCTGGTCTTCGAGTTCTGCGAGCTGACCGTGCTGCACGAACTGGAGCGGCATCCACAG 288
Query: 795 GGCTGCCCGGAGCACCTGACCAAACAGATCTGCTACCAGACCCTGCTGGGCGTGGCCTAC 736
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 289 GGCTGCCCGGAGCACCTGACCAAACAGATCTGCTACCAGACCCTGCTGGGCGTGGCCTAC 348
Query: 735 TGCCACAAGCAGGGCTGCCTACACCGCGACATCAAGCCGGAGAACATTCTGCTGACGGCC 676
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 349 TGCCACAAGCAGGGCTGCCTACACCGCGACATCAAGCCGGAGAACATTCTGCTGACGGCC 408
Query: 675 CAGGGTCAGGTGAAGCTGTGTGACTTCGGCTTCGCCCGGATGCTCAGTCCGGGCGAGAAT 616
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 409 CAGGGTCAGGTGAAGCTGTGTGACTTCGGCTTCGCCCGGATGCTCAGTCCGGGCGAGAAT 468
Query: 615 TACACGGACTACGTGGCCACCAGATGGTACCGGGCGCCGGAGCTGCTGGTGGGCGACACT 556
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 469 TACACGGACTACGTGGCCACCAGATGGTACCGGGCGCCGGAGCTGCTGGTGGGCGACACT 528
Query: 555 CAGTACGGCACTCCGGTGGACGTCTGGGCCATCGGTTGCCTCTTCGCCGAGCTGGTCCGG 496
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 529 CAGTACGGCACTCCGGTGGACGTCTGGGCCATCGGTTGCCTCTTCGCCGAGCTGGTCCGG 588
Query: 495 GGCGAGGCCCTCTGGCCAGGACGTAGCGATGTGGATCAGCTCTATCTGATCCGCAAGACG 436
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 589 GGCGAGGCCCTCTGGCCAGGACGTAGCGATGTGGATCAGCTCTATCTGATCCGCAAGACG 648
Query: 435 CTCGGCGACCTGCTGCCGCGCCACATCCAGATCTTTGGACAGAACGAGTACTTTAAGGGC 376
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 649 CTCGGCGACCTGCTGCCGCGCCACATCCAGATCTTTGGACAGAACGAGTACTTTAAGGGC 708
Query: 375 ATCACGCTGCCAGTGCCGCCGACGCTGGAGCCGCTGGAGGACAAGATGCCGGCCAAGTCG 316
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 709 ATCACGCTGCCAGTGCCGCCGACGCTGGAGCCGCTGGAGGACAAGATGCCGGCCAAGTCG 768
Query: 315 CAGCAGAATCCCCTGACCATTGACTTTCTCAAGAAGTGCCTGGACAAGGATCCGACCAAG 256
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 769 CAGCAGAATCCCCTGACCATTGACTTTCTCAAGAAGTGCCTGGACAAGGATCCGACCAAG 828
Query: 255 CGCTGGTCCTGCGAGAAGCTCACAAAGCACTCCTACTTCGATGACTACATCGCTAAGCAG 196
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 829 CGCTGGTCCTGCGAGAAGCTCACAAAGCACTCCTACTTCGATGACTACATCGCTAAGCAG 888
Query: 195 CGCGAACTGGAGCACGTCAACAGCCTGGAGGCGGCCAATCTCCGCCAGCAGCAGCTCGCC 136
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 889 CGCGAACTGGAGCACGTCAACAGCCTGGAGGCGGCCAATCTCCGCCAGCAGCAGCTCGCC 948
Query: 135 TCCCAGCAGTTCATGCTGGCCACGGCGGCCCAGCAGCTCCAGACGGGTCCTGCTCAGGCG 76
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 949 TCCCAGCAGTTCATGCTGGCCACGGCGGCCCAGCAGCTCCAGACGGGTCCTGCTCAGGCG 1008
Query: 75 GCGGCCATCGCGGCGGCCCGGGATAAATCAAAG 43
|||||||||||||||||||||||||||||||||
Sbjct: 1009 GCGGCCATCGCGGCGGCCCGGGATAAATCAAAG 1041
100085-99918
\------------
>CG7236|FBgn0031730|CT22313|FBan0007236  last_updated:000321 
Length = 1179
Minus Strand HSPs:
Score = 835 (125.3 bits), Expect = 2.6e-32, P = 2.6e-32
Identities = 167/167 (100%), Positives = 167/167 (100%), Strand = Minus / Plus
Query: 167 TGGATCGCTATGAGAAGCTCAGTCGGCTGGGCGAGGGCTCCTACGGTGTGGTCTACAAGT 108
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2 TGGATCGCTATGAGAAGCTCAGTCGGCTGGGCGAGGGCTCCTACGGTGTGGTCTACAAGT 61
Query: 107 GCCGGGATCGGGAAACGGGTGCTCTGGTGGCGGTCAAGAGGTTTGTGGAGTCCGAGGATG 48
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 62 GCCGGGATCGGGAAACGGGTGCTCTGGTGGCGGTCAAGAGGTTTGTGGAGTCCGAGGATG 121
Query: 47 ATCCAGCGATTCGTAAAATTGCACTGCGAGAAATTAGGCTACTGAAG 1
|||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 122 ATCCAGCGATTCGTAAAATTGCACTGCGAGAAATTAGGCTACTGAAG 168
DOI
Associated Information
Comments
Associated Files
Other Information
Secondary IDs
    Language of Publication
    English
    Additional Languages of Abstract
    Parent Publication
    Publication Type
    Abbreviation
    Title
    ISBN/ISSN
    Data From Reference
    Genes (3)