Open Close
Reference
Citation
Misra, S. (2001.8.16). FlyBase error report for CG12573 on Thu Aug 16 15:08:18 2001. 
FlyBase ID
FBrf0137497
Publication Type
Personal communication to FlyBase
Abstract
PubMed ID
PubMed Central ID
Text of Personal Communication
From: FlyBase-error@XXXX
Date: Thu, 16 Aug 2001  15:08:18  \-0700 (PDT)
To: flybase-updates@XXXX
Cc: sima@XXXX
Subject: FlyBase error report for CG12573 on Thu Aug 16  15:08:18  2001
Error report from Sima Misra (sima@XXXX)
Gene or accession: CG12573
Release: 1
Gene annotation error
Gene CG12573 has incorrect exon/intron structure or translation start site.
Comments: CG12573 shows a good match (70%id) to part of the Waldo-A transposon
from 1-511 of its
1001bp.
Query= CG12573|FBgn0040029|CT34341|FBan0012573 GO:<up></up> located on: U; |cDNA
sequence
(1001 letters)
Database: /data/blast/db/na_te.dros
55 sequences; 282,078 total letters.
Searching....10....20....30....40....50....60....70....80....90....100% done
Smallest
Sum
High
Probability Sequences producing High-scoring Segment Pairs: Score
P(N) N
gb|AC005734|Waldo-A WALDOA 5150bp 763 4.4e-31
1 gb|AC005847|Waldo-B WALDOB 5180bp 237 0.00018
1 gb|AJ278684|pilger DME278684 5108bp Derived from AJ278684... 235 0.00023
1
>gb|AC005734|Waldo-A WALDOA 5150bp
Length = 5171
Plus Strand HSPs:
Score = 763 (120.5 bits), Expect = 4.4e-31, P = 4.4e-31
Identities = 263/371 (70%), Positives = 263/371 (70%), Strand = Plus / Plus
Query: 40 CTGCTGGTGGCGGTAGCAAAGGCTACTAACAGGGGTTCGTACCTGAAAAGAGCGCGCTCG 99
|||| | | | ||||| | | ||| ||||| || ||||||||| |||| || |||
Sbjct: 4186 CTGCACCAGTCTGGAGCAATGCC-ACTGGCAGGGTCTCATACCTGAAAGGAGCTCGTTCG 4244
Query: 100 GGGCTACGGTCCATGGCCCTCAGGCTCATCAGAGGTTTCAGGACCATATCCGAAGACGCG 159
| ||||||||| ||| | || |||||||| ||||||||||||||||||||||||||||||
Sbjct: 4245 GTGCTACGGTCAATGTCTCTGAGGCTCATTAGAGGTTTCAGGACCATATCCGAAGACGCG 4304
Query: 160 GCGCTAGCACTGTCAGGCCTTCCACCAATTGATCTGGAGATCAAGGCATTCAGCCTAAAG 219
|||||||| ||| ||||||| || || |||||||||||||||||||| ||||||||| |
Sbjct: 4305 GCGCTAGCGCTGGCAGGCCTGCCGCCGATTGATCTGGAGATCAAGGCTCTCAGCCTAATG 4364
Query: 220 CGGGGTGGCGCCTCCTGGCTAGAGGCACACGTGTGGATGCTGGCCCTAGTGGCCTGTTCG 279
||| ||||||| ||| ||| ||||||||||| |||| | | | | |||| |
Sbjct: 4365 CGGAGTGGCGCTTCCAGGCAAGAGGCACACGAGTGGCTATTAGGTGAA-TGGCA-GA--- 4419
Query: 280 CGGCTGGTGGCGAACAGT-GAGGCATCGGAGCTGGG-TCA-CAGCCTTATCATTAAG-TC 335
| | |||| ||| || | | | |||| ||| | | |||| | ||| || |
Sbjct: 4420 \-GTA-GATGGCAAAC-GTCGCGACGGGGGAGGTGGACTTATCAGC-TCATCCCAGAGATG 4475
Query: 336 \-CGATCAGACGAGATGGCCAACAGAG-TGGGTGG-CTA--AGCTCAAACAGT-CGTCCCG 389
|| | | ||| ||||||| | || ||| ||| | || | |||| | || ||
Sbjct: 4476 ACGGTTTGGGCAGAGTGCCAACACAAATGCTTGGACTACCACCTAACCCAGTTCCTCACG 4535
Query: 390 TGTGGTGGCGG 400
|||| |
Sbjct: 4536 GACCATGGCTG 4546
Score = 398 (65.8 bits), Expect = 4.1e-18, Sum P(2) = 4.1e-18
Identities = 154/226 (68%), Positives = 154/226 (68%), Strand = Plus / Plus
Query: 291 GAACAG-TGAGGCATCGGAGCTGG--GTCACAGCCTTATCATTAAGTCCGATCAGACGAG 347
|| || || | || | ||| ||| ||| |||| | | | |||| |||| |
Sbjct: 4797 GACGAGATG-GCCAACAGAG-TGGATGTCTAAGCCCAAAC-TGGTGTCCTGGGTGACG-G 4852
Query: 348 ATGGCCAACAGAGTGGGTGGCTAAGC-TCAAACAG-TCGTCCCGTGTGGTGGCGGGCGAA 405
||| || | | | | || ||| || | | ||||| || | | |
Sbjct: 4853 CGGGCGAAGA-ATTCA-TC-CTCAGCGTCCC-CGGCTCGTCGTAAAAGGCGACTAAAGG- 4907
Query: 406 GAGGAAGCAGGAGCCCTCATGGACTCCAATGAAGGATTGGAGTGCGATTTGTCCTCACAT 465
| ||||| |||||||| |||||||| || ||||||| ||||||||| || ||||||||
Sbjct: 4908 GTGGAAGGAGGAGCCCCCATGGACTACACTGAAGGAAGGGAGTGCGACCTGGCCTCACAT 4967
Query: 466 CCTGCGCACCGAAGTCATACCTTGACTGGCAGTCCCGGGGGTCGCG 511
||||| |||||||||||||||||||||||||||||||| | || |
Sbjct: 4968 CCTGCTCACCGAAGTCATACCTTGACTGGCAGTCCCGGTGAGCGAG 5013
Score = 285 (48.8 bits), Expect = 1.1e-12, Sum P(2) = 1.1e-12
Identities = 65/75 (86%), Positives = 65/75 (86%), Strand = Plus / Plus
Query: 333 GTCCGATCAGACGAGATGGCCAACAGAGTGGGTGGCTAAGCTCAAACAGTCGTCCCGTGT 392
||||||||||||||||||||||||||||||| || |||||| ||||| | |||| | ||
Sbjct: 4788 GTCCGATCAGACGAGATGGCCAACAGAGTGGATGTCTAAGCCCAAACTGGTGTCCTGGGT 4847
Query: 393 GGTGGCGGGCGAAGA 407
| ||||||||||||
Sbjct: 4848 GACGGCGGGCGAAGA 4862
Score = 280 (48.1 bits), Expect = 1.8e-06, P = 1.8e-06
Identities = 86/113 (76%), Positives = 86/113 (76%), Strand = Plus / Plus
Query: 262 GCCCTAGTGGCCTGTTCGCGGCTG-G-TGGCGAACAGTGAGGCATCGGAGCTGGGTCACA 319
||||||||||| ||||||||||| | |||||||||| | ||| | ||||| ||| ||||
Sbjct: 4702 GCCCTAGTGGCTTGTTCGCGGCTATGATGGCGAACAGGGGGGCTTGGGAGCGGGGACACA 4761
Query: 320 GCCTTATCATTAAGTCCGATCAGACGAGATGGCCAA-CAGAGTGGGTGGCTAA 371
|| |||||||||| | ||| | | | | || || | |||| | |||| ||
Sbjct: 4762 GCATTATCATTAA-TATGATGA-A-GCG-TGTCCGATCAGACGAGATGGCCAA 4810
Score = 261 (45.2 bits), Expect = 4.1e-18, Sum P(2) = 4.1e-18
Identities = 195/330 (59%), Positives = 195/330 (59%), Strand = Plus / Plus
Query: 1 ATGCCCAACTTCGGTGGCCCAAGATCTCCGGCCAGGAAACTGCTGGTGGCGGTAGCAAAG 60
||||||||| |||| ||||||||| ||||||||||||||||||||| | |||||||||
Sbjct: 4110 ATGCCCAACGTCGGAGGCCCAAGACACCCGGCCAGGAAACTGCTGGTGTCAGTAGCAAAG 4169
Query: 61 GCTACTA-AC-AGGGGTTCGTACCTGAAAAGAGCGC-GCTCGGGGCTACGGTC-CATGGC 116
||| | || | | | | ||| | |||| || ||| | |||| ||| |
Sbjct: 4170 GCTTCGCTACTATACGCT-GCACCAGTCTGGAGCAATGCCACTGGC-AGGGTCTCATACC 4227
Query: 117 CCTCAGG--CTCATCAGAGGTTTCAGGACCATATCCGAAGACGCGGCGCTAGCACTGTCA 174
||| ||| | | | | | || | || || || || | ||| | |||
Sbjct: 4228 TGAAAGGAGCTCGTTCGGTGCTAC-GGTCAATGTCTCT-GAGGCT-CATTAGAGGTTTCA 4284
Query: 175 GG-CC-T-TCC-ACCAATTGAT-CTGGAGATCA-AGGCATTCAGCCTAAAGCGGGGTGGC 228
|| || | ||| | | | || | | | |||| | | ||| | | |||
Sbjct: 4285 GGACCATATCCGAAGACGCGGCGCTAGCGCTGGCAGGCCTGCCGCCGATTGATC--TGGA 4342
Query: 229 GCCTCCTGGCTAGAGGCACACGTGTGGATGCTGGCCCTAGT-GGCCTGTTCGCGGCTG-G 286
| || |||| || | || ||| | |||| || ||| | || | |
Sbjct: 4343 GA-TCAAGGCTCTCAGCCTAA-TGCGGA-G-TGGCGCTTCCAGGCAAGAG-GCACACGAG 4397
Query: 287 TGGCGAACAG-TGA--GGCATCGGAGCTGG 313
|||| | || ||| |||| | || |||
Sbjct: 4398 TGGCTATTAGGTGAATGGCAGAGTAGATGG 4427
DOI
Associated Information
Comments
Associated Files
Other Information
Secondary IDs
    Language of Publication
    English
    Additional Languages of Abstract
    Parent Publication
    Publication Type
    Abbreviation
    Title
    ISBN/ISSN
    Data From Reference
    Genes (1)
    Natural transposons (1)