Home
Reference Report
| Reference | |||
|---|---|---|---|
| Citation | Misra, S. (2001.8.16). FlyBase error report for CG12614 on Thu Aug 16 15:11:53 2001. (Export to RIS) | ||
| FlyBase ID | FBrf0137498 | ||
| Publication Type | Personal communication to FlyBase | ||
| PubMed ID | |||
| PubMed Abstract | |||
| Text of Personal Communication |
From: FlyBase-error@XXXXXXXXXXXXXXX
Date: Thu, 16 Aug 2001 15:11:53 \-0700 (PDT) To: flybase-updates@XXXXXXXXXXXXXXX Cc: sima@XXXXXXXXXXXXXXX Subject: FlyBase error report for CG12614 on Thu Aug 16 15:11:53 2001 Error report from Sima Misra (sima@XXXXXXXXXXXXXXX) Gene or accession: CG12614 Release: 1 Gene annotation error I have new supporting evidence or functional assignment for gene CG12614. Comments: CG12614 can be deleted from GadFly--it appears to be part of a Waldo-A element (just 85% identity but over its whole length). Query= CG12614|FBgn0039981|CT35018|FBan0012614 GO:<up></up> located on: U; |cDNA sequence (318 letters) Database: /data/blast/db/na_te.dros 55 sequences; 282,078 total letters. Searching....10....20....30....40....50....60....70....80....90....100% done Smallest Sum High Probability Sequences producing High-scoring Segment Pairs: Score P(N) N gb|AC005734|Waldo-A WALDOA 5150bp 1170 1.5e-49 1>gb|AC005734|Waldo-A WALDOA 5150bp Length = 5171 Plus Strand HSPs: Score = 1170 (181.6 bits), Expect = 1.5e-49, P = 1.5e-49 Identities = 270/315 (85%), Positives = 270/315 (85%), Strand = Plus / Plus Query: 1 ATGAATGGCAAGATAAACATCCTGCTATCCGCATTCGAGACTCAACGGAACGTCACAAGA 60 |||||||||||||| | || | ||||||||||||||||||| |||||| |||| ||| || Sbjct: 752 ATGAATGGCAAGATCAGCACCTTGCTATCCGCATTCGAGACCCAACGGCACGTGACACGA 811 Query: 61 GAGACTAAGGGCGTAGCTTCTGAACGCTCAGCCCTTAACAACAGGGCGAAAGAGCTGTAT 120 ||||| |||||| ||||||| |||| |||||||||||||||||||||| ||||||||| Sbjct: 812 GAGACAAAGGGCATAGCTTCCGAACTCTCAGCCCTTAACAACAGGGCGTTAGAGCTGTAC 871 Query: 121 GAAGGTGCAACTAGCGAGCACCGCGTGACGACCAGTTCTACCCAGACGGAGCCAAAAAAG 180 ||||| | ||||||||||||||| ||| || |||| |||||||||||||| | ||||| Sbjct: 872 AAAGGTACTACTAGCGAGCACCGCTTGAAGAGCAGTGCTACCCAGACGGAGGTACAAAAG 931 Query: 181 CCAACCAAAAAGGTTTCTCACAATGCGCCGGAGCCCAAGGGGCAAGTGCCCAAAGTCCAG 240 || |||||||||| | |||| ||||| | || ||||||| ||||||||| ||| ||||| Sbjct: 932 CCTACCAAAAAGGCTCCTCAAAATGCACAGGTACCCAAGGTGCAAGTGCCAAAAATCCAG 991 Query: 241 GCGCCCAAGCCGAGGAACAACACGATGGGTGGCAACGGTGAAGGAAAGGCGACACCCAGA 300 |||||||||||||| ||| ||| |||||||||||||||||| |||||| ||| ||||| Sbjct: 992 GCGCCCAAGCCGAGCAACCCTACGTTGGGTGGCAACGGTGAAGAAAAGGCAACATCCAGA 1051 Query: 301 CCAAATGAGTCCAAA 315 ||||| ||||||||| Sbjct: 1052 CCAAACGAGTCCAAA 1066 |
||
| DOI | |||
| Related Publication(s) | |||
Recent Updates
|
|||
| Description |
What does this section display?
This section contains items that were added to this record for each release.
It currently only tracks new links between this FlyBase report and other
FlyBase data classes (e.g. genes, references, stocks) or controlled
vocabulary terms (e.g. GO, anatomy terms).
What does this section not display?
This section does not currently display links that were removed or gene model changes.
|
||
| Update Feed |
Click the icon below to subscribe to this FlyBase record and receive updates automatically through your
feed reader.
|
||
| FB2013_03 | |||
| FB2013_02 | |||
| All updates | Click here to see a list of all updates to this record from FB2010_08 and on. | ||
|
Associated Information
|
|||
| Comments | |||
| Associated Files | |||
|
Other Information
|
|||
| Secondary IDs | |||
| Language of Publication | English | ||
| Additional Languages of Abstract | |||
| Also Published As | |||
|
Parent Publication
|
|||
| Publication Type | |||
| Abbreviation | |||
| Title | |||
| ISBN/ISSN | |||
|
Data from Reference
|
|||
| Natural transposons (1)
|
|||