Home
Reference Report
| Reference | |||
|---|---|---|---|
| Citation | Pace, N.R., Marquez, S., Harris, J.K. (2001.9.28). FlyBase error report for Ribonuclease P RNA on Fri Sep 28 10:51:04 2001. (Export to RIS) | ||
| FlyBase ID | FBrf0139871 | ||
| Publication Type | Personal communication to FlyBase | ||
| PubMed ID | |||
| PubMed Abstract | |||
| Text of Personal Communication |
Date: Fri, 28 Sep 2001 10:51:05 \-0700 (PDT)
To: flybase-updates@XXXXXXXXXXXXXXX Cc: marquezs@XXXXXXXXXXXXXXX Subject: FlyBase error report for Ribonuclease P RNA on Fri Sep 28 10:51:04 2001 Error report from Dr. Norman R. Pace, Steven Marquez, J. Kirk Harris (marquezs@XXXXXXXXXXXXXXX) Gene or accession: Ribonuclease P RNA Release: 2 Missed gene Comments: We have blasted the D.melanogaster database with conserved sequences found in Ribonuclease P RNA subunit. This RNA has secondary structure consistent with other eucaryal RNase P RNAs. Based on database sequence, we have PCR amplified this gene from genomic DNA and it's sequence matched the sequence in the database. We have not identified the exact 5' and 3' termini of the gene. D. melanogaster RNase P RNA can be found in AE003777.1 position 55063-54764. Here is the sequence: AGTCAGTTGCAAACTAGCATCTGGGGCCCACACAACGAGTATCTGATTACTCCACAAACCATTGCCCCGGGAAGGTCTG AGAATCGGCCGAGCCAGCTGTTTGTTGCGGCTTCATTTCCCAGCAGGAAACCTGTGTGATTGCAGGGCGAAAGTACCAG AAATCCTGCTACCAGGTGTTGCCGTTGCCCCCGGTGACCGCCGCCTGGTTGGCATTGAAACCTTTCGTGGCCAGCGTTT TTAGTGCGATGTGCTTGCTGCCTCTAAGGCAGAACTCAATTCAGACTAATCTGTGACTGACT |
||
| DOI | |||
| Related Publication(s) | |||
Recent Updates
|
|||
| Description |
What does this section display?
This section contains items that were added to this record for each release.
It currently only tracks new links between this FlyBase report and other
FlyBase data classes (e.g. genes, references, stocks) or controlled
vocabulary terms (e.g. GO, anatomy terms).
What does this section not display?
This section does not currently display links that were removed or gene model changes.
|
||
| Update Feed |
Click the icon below to subscribe to this FlyBase record and receive updates automatically through your
feed reader.
|
||
| FB2013_03 | |||
| FB2013_02 | |||
| All updates | Click here to see a list of all updates to this record from FB2010_08 and on. | ||
|
Associated Information
|
|||
| Comments | |||
| Associated Files | |||
|
Other Information
|
|||
| Secondary IDs | |||
| Language of Publication | English | ||
| Additional Languages of Abstract | |||
| Also Published As | |||
|
Parent Publication
|
|||
| Publication Type | |||
| Abbreviation | |||
| Title | |||
| ISBN/ISSN | |||
|
Data from Reference
|
|||
| Genes (1)
|
|||