Open Close
Reference
Citation
Graham, L. (2002.6.18). Drosophila odorant binding protein annotations. 
FlyBase ID
FBrf0149614
Publication Type
Personal communication to FlyBase
Abstract
PubMed ID
PubMed Central ID
Text of Personal Communication
From: Sherry Gauthier <syg@XXXX>
To: cdsmith@XXXX
Subject: Drosophila odorant binding protein annotations
Date: 18 Jun 2002  19:40:49  \-0400
Dear Dr. Smith
Here are the files via our technician's e-mail account.
Sincerely
Laurie Graham
\----
Hello
We amplified cDNAs corresponding to 21 of the 38 Odorant binding protein
homologues in
Drosophila. This work is in press (Graham L.A. and Davies P.L. 2002 The
odorant-
binding proteins of Drosophila melanogaster: Annotation and characterization
of a
divergent gene family. Gene). I have given the coding sequences below with
notes
describing how our annotation compares with that done on the whole genome.
Comparisons are
also made with the annotations given by Galindo & Smith (Galindo K, Smith DP
(2001) A
large family of divergent Drosophila odorant-binding proteins expressed in
gustatory and
olfactory sensilla. Genetics 159(3):1059-72) or by Hugh Robertson via
annotation updates.
Our cDNAs were amplified from Canton-S so between 0-8 polymorphisms were
observed per gene.
The primers that we used to amplify the cDNAs are shown with each sequence.
The 3' primer
is shown in reverse complement so you can easily visualize its position relative
to the cDNA sequence. The cDNA was derived from a mixture of all
developmental stages
(embryo-adult). All of the genes contain at least one intron which was absent
in the cDNA
sequence except Obp99d and Obp99b. Obp99b was independently confirmed by ESTs.
OBPs typically contain 6 highly conserved Cys residues. However, some family
members only
contain 4 of these in which case Cys 2 and 5 are not present. Others contain
insertions or
deletions. These differences are noted below.
In the cases where a gene name has not been given by Galindo & Smith, we have
noted a
compatible gene name below (Obp followed by the band number with an alphabetic
suffix ex.
Obp23a).
> CG13517 Original gene prediction is fine. New name proposed...Obp59a. My
coding
> sequence shown below. Amplified from first strand cDNA using the following
primers.
> 5' end CACGGATCCCAAGATGAAACAGTTGAT 3' end GCTCTTCAATTAGGATTAAACTCGAGAGG.
> This isoform contains two insertions (60 a.a. Gly-rich insert \+ 15 a.a.
insert) each
> containing a Cys residue (for 8 Cys in total).
ATGAAACAGTTGATTTTCCTGCTGATTTGCTTGAGCTGCGGCACCTGCTC
CATTTACGCACTGAAATGCAGATCCCAGGAGGGACTAAGTGAAGCGGAACTCAAGCGAAC
TGTGCGCAACTGTATGCATCGCCAGGACGAGGACGAAGATCGAGGACGAGGTGGACAGGG
CCGGCAAGGAAATGGCTATGAGTACGGTTACGGAATGGATCAGGATCAGGAGGAGCAGGA
CAGGAATCCAGGCAACAGGGGCGGCTATGGCAATCGAAGGCAGCGAGGACTAAGGCAATC
GGATGGCAGGAACCACACCAGCAACGATGGAGGTCAGTGTGTGGCCCAGTGCTTTTTCGA
GGAGATGAATATGGTGGATGGCAATGGGATGCCCGATCGGCGCAAGGTGAGCTATTTGCT
GACCAAGGACCTTCGGGACCGGGAGCTGCGCAACTTCTTCACGGACACCGTGCAGCAGTG
CTTCCGCTATCTGGAGAGCAACGGAAGGGGCCGGCACCACAAGTGTTCAGCGGCCCGGGA
ACTGGTCAAGTGCATGTCGGAGTACGCGAAGGCGCAGTGCGAGGATTGGGAGGAGCACGG
CAACATGCTCTTCAATTAG
> CG15883 Obp18a Original gene prediction incorrectly identified the first
exon. Our cDNA
> is compatible with the prediction made by Hugh Robertson in his annotation
updates. The
> sequence predicted in Galindo & Smith 2001 has 3 extra a.a. that we did not
observe.
> 5' end catgaaggttgtgtgcag 3' end ctatcgcctcgtaatttacctcgaggtg. Also
confirmed by ESTs
> (see BI243891. RE41704.5prime RE...<up> gi:14712817 </up>).
ATGAAGGTTGTGTGCAGCATAGCTGTACTATGGATTTGCTTGATAACTATGTGG
CAATCAGCTGGCCGCGTTAACGCAGAGGGTTGCCTAAAGCACCACAATCTGACCAGTGCC
CAAGTGCAGGCAGTGGCTCCATCCACTCCCGTTGCGGATGTTCCAGTGGCCGTTAAGTGC
TATAGCCGGTGTCTGATCCAGGATTATTTCGGTGATGATGGGAAAATCGATCTGCAGAAG
GTGGGAAAGCGAGGATCTCAAGAGGACCACGTGATTTTGTCCCAGTGTAAGCAGCAGTTC
GATGGCGTCACCAATCTGGACACGTGCGACTATCCATACCTAATTCTCCAGTGTTATTTT
AAGGGCAAGCAGAGTGGAACTATCGCCTCGTAA
> CG15457 Obp19c Original gene prediction is fine.
> 5' end GAAGGATCCAAGATGAAGCCATCCACT 3' end GTCTGGTAGAGGACATCTCGAGGTG
ATGAAGCCATCCACTCCAGTCGCAGCCATTCCGCTAATGACGATAGTGGTC
GCTGTCCTGCTGCAGACGCACTGCGTCCGTGGCCAGACCCAGGCTTTCGATCTCGCCAAG
CTGCTGCCCAAGACCGGAACGGAGCCCATCTGGGCGGTAATCGATCGCAACTTGCCGCAG
GTGCAGGAGCTGGTCACCGCGGCCAGGATGGAGTGCATCCAGAAGCTGCAGCTGCCCAGG
GACCAGCGACCGCTGGGGAAGGTGACCAATCCAAGTGAGAAGGAGAAGTGCCTGGTGGAG
TGCGTGCTCAAGAAGATCAAGTTGATGGACGCCGACAACAAGCTGAACGTTGGCCAGGTG
GAGAAGCTGACCAGCCTGGTGACCCAGGACAACAAGATGGCCATCGCCGTTAGCTCCAGC
ATGGCGCAGGCCTGCAGCCGCGGCATCTCCTCGAAGAACCCCTGCGAGGTGGCCCACCTC
TTCAACCAGTGCATCAGTCGCCAGCTGGAACGCAACAACGTAAAGCTGGTCTGGTAG
> CG11748 Obp19a I agree with Hugh Robertson that the initiator Met is
closer than
> originally predicted. There is a high scoring TATA-containing promoter well
> positioned relative to this later Met. The second intron proposed by
Galindo & Smith
> is longer than the intron we observed.
> 5' end gaaggatccggaaatgaagttccatctg 3'end gtattcgtgtttccctaggctcgaggtg
ATGAAGTTCCATCTGCTGCTGGTCTGCGTCGCCATATCCCTGGGCCCAAT
CCCCCAGTCGGAGGCAGGGGTGACGGAGGAGCAGATGTGGTCTGCCGGAAAGCTGATGCG
CGATGTCTGCCTGCCCAAGTATCCGAAGGTCAGCGTCGAGGTGGCCGACAACATTCGCAA
CGGTGACATACCCAATAGCAAGGACACCAACTGCTACATCAATTGCATCCTGGAAATGAT
GCAGGCAATCAAGAAGGGAAAGTTCCAGCTGGAGTCGACCCTCAAGCAGATGGACATCAT
GCTGCCGGACAGCTACAAGGACGAGTACCGCAAGGGCATCAATCTGTGCAAGGACTCCAC
CGTCGGCCTGAAGAACGCCCCCAACTGCGATCCCGCCCACGCCCTGCTCAGCTGCCTGAA
GAACAACATCAAGGTATTCGTGTTTCCCTAG
> CG15583 Obp83g This region contains three OBP motifs that were originally
predicted to
> be fused into one construct. I agree with Hugh Robertson that the first
motif forms a
> separate gene. One codon was absent in our Canton-S construct. We did
check for
> alternative splicing to the other motifs using PCR but this was the only
product
> recovered. 5'-end gaaggatccagaaatgcagtcccaatc 3'-end
ggtcttcgcctgacctgaatctcgagagg.
> EST data supports this gene structure (see BI229555.RE27361.5prime
RE...<up> gi:14696819 </up>).
ATGCAGTCCCAATCCCTCCTGCTGATCGCAGCCGTTGCCACGTTTCT
GGTGGCCCAGACTACGGCCAAGTTCCGGCTGAAGGACCACGCCGACGCAGAGAAGGCGTT
CGAGGAGTGCCGTGAGGACTACTACGTGCCGGACGACATCTACGAGAAGTACCTGAACTA
CGAGTTTCCCGCCCACCGGCGCACCAGCTGCTTCGTCAAGTGCTTCCTGGAGAAGCTTGA
GCTGTTCTCGGAGAAGAAGGGATTTGACGAGCGCGCCATGATCGCCCAGTTCACCTCCAA
GAGCAGCAAAGACCTGTCCACGGTCCAGCACGGCCTGGAGAAGTGCATCGACCACAACGA
GGCCGAGTCGGATGTCTGCACCTGGGCCAACCGAGTCTTCTCCTGCTGGCTGCCCATCAA
CCGCCACGTGGTGCGTAAGGTCTTCGCCTGA
> CG15583 Obp83f (Obp83e). This is the second portion of the original
prediction
> containing two OBP motifs. These motifs are not separated by an intron.
Galindo &
> Smith predicted a monomer at this location and Hugh Robertson suggested
either a monomer
> or a dimer and raised the possibility of alternative splicing. A cDNA
containing a
> single motif could be produced by removal of an intron which would introduce
a stop codon
> to the end of the first motif. However, the PCR products obtained were not
spliced at
> this location. Rather, the cDNA contains two fused OBP motifs (Obp83f \+
Obp83e) and is
> an 'obligate heterodimer'. 5'-end CACGGATCCGCAGAGAGATGAGTTCC
> 3'-end GAGGACAACGAAGAGCAGTAGAAGCTTGTC. To check for alternative
splicing..used internal
> primer ctgtcgacta agtgggactcgagagg in combination with primer at 5' end.
Also used 5'
> primer of Obp83g in combination with these two 3' primers and did not
recover a product,
> indicating that this locus does encode two separate genes (monomer and an
obligate
> heterodimer). No evidence of alternative splicing.
ATGAGTTCCTCTCGTGCGGTTCTAGTCAGCCTGTTCCTGATCTGCAGTCAGGCACTAGCT
GACCTTTCTGGTGATGCCCAGACTCTGGAAAAGTGCCTGCGGGAACTTAGTTCGCCGGAG
AGCATTGCTGGCGATCTTCGAAAGCTGGAACGGTATTCATCTTGGACGCGGGAGGAGGTA
CCTTGCCTGATGCGCTGCTTGGCCAGAGAAAAGGGCTGGTTCGACGTGGAGGAAAACAAG
TGGAGGCTCAAGCAACTGACTGAGGACCTGGGCGCCGATGTCTATAACTACTGCAGATTC
GAGCTGCGCCGGATGGGGTCCGATGGCTGCAGCTTCGCCTATCGGGGACTCAGGTGCCTG
AAGCAGGCCGAGATGCATGCGGGCACCAGCCTGAGCACACTGCTACAGTGTTCCCGCCAG
CTGAACGCCACCAACGTGGAGCTGCTGCAGTACAGTAAGCTGAAGTCAAAGGAACCTATT
CCCTGCCTCTTTCAGTGCTTTGCGGATGCCATGGGATTCTACGATCCCGATGGAAACTGG
CGGCTGGAAAACTGGAAGCAGGCGTTTGGGCCTTCCGGAAATGAGGATCAGTCTTCTGGC
GCTGACTACAGTGGCTGTCGACTAAGTGGGACTCAGCGGGAGGTGGCGCTAAGCAAGTGC
TCGTGGATGTACCATGAGTACAAATGCTGGGAGCGAGTAAATGGGAATAAGCTAGTGGAG
GACAACGAAGAGCAGTAG
> CG15582 Obp83c/d This was originally annotated as a fusion of two OBP
motifs but the 5'
> exon was not predicted correctly and did not encode a signal peptide.
Galindo & Smith
> predicted two separate genes and Hugh Robertson raised the possibility of
alternative
> splicing or a heterodimer. I agree with Robertson that there is no suitable
signal
> peptide for the second half of the gene. If the intron separating the two
motifs was
> not removed, a monomer would be produced. Alternatively, the second motif
could be
> spliced to the signal peptide encoding exon upstream of the first motif.
Using primers
> to test each possibility, we only recovered a cDNA encoding the obligated
heterodimer
> and found no evidence of alternative splicing. In addition, although the
portion of the
> ESTs sequenced does not include the entire coding sequence, it is long
enough to confirm
> the heterodimeric structure (see gi|15319558|gb|BI485590.1|BI485590).
> 5'end-GAAGGATCCGCAATGCAGATGAAAAGTG GA 3' end-CTACG CGATGGCTGTTTAGCTCGAGGTG
ATGCAGATGAAAAGTGGAATATTAATAGCATTATGTCTATGCCTTTCGTTG
AACGAAGGCCTGGCCCTTCTGGAGCACGAAGGCGAGACCATCAACAGATGCATCCAAAAC
TATGGCGGACTTACTGCGGAAAATGCCGAACGTCTAGAACGATTCAAGGAATGGTCGGAT
AGCTACGAGGAAATCCCCTGCTTCACGCGCTGCTATTTGTCCGAGATGTTCGACTTTTAC
AATAACTTAACGGGCTTCAATAAGGACGGAATTGTGGGCGTCTTTGGAAGACCCGTCTAC
GAAGCCTGCCGAAAGAAATTGGAACTGCCATTCGAATCAGGCGAGAGCAGCTGCAAACAT
GCCTACGAGGGCTTCCACTGCATCACCAACATGGAAAGCCACCCGTTCACGGTTATTGAC
AACATGCCAAACATATCCCCGTCGGCCAAGGATGCAATGAAGGACTGCCTGCAGGATGTC
CACCAGGACGAGTGGAAGAGCTTCGATGCCTTCGCCTACTATCCTGTCAATGAACCGATT
CCGTGCTTCACCCGGTGCTTCGTGGACAAGCTGCATATCTTCGAGGAGAAAACGCGTCTT
TGGAAACTGGAGGCGATGAAGCAAAACCTGGGCATTCCGGCCAAAGGAGCTCGCATAAGG
ACCTGCCATCGGCACCGCGGCAGGGACCGATGTGCCACATATTACAAACAGTTCACCTGC
TACGCGATGGCTGTTTAG
> CG155505 New name proposed...Obp99d. This is a four-Cys isoform. The
original gene
> prediction is fine. This OBP has a small internal deletion of about 17 a.a.
relative
> to other OBPs.
> 5' end-gaaggatccgcaatgaatca cttgagac 3'end-ggaagtggaa cgatgaaatactcgaggtg
ATGAATCACTTGAGACTGGAGATCATCTGCTGGAGCTGCCTGCTTATTGCG
ATGGCTGTTATCACGGAAGCTGCTTCTGTTTGGAAACTACCCACCGCGCAGATGGTCTAC
GAGGATCTGGAGAAGTGTCGCCAAGAAAGCCAAGAAGAGGATGCTGCTACCCTGAGGTGT
TTGGTTAAGAAACTGGGTCTTTGGACGGATGAGAGTGGCTACAATGCCAGGCGGATAGCA
AAGATCTTTGCCGGACACAACCAGATGGAGGAGCTGATGCTGGTGGTGGAGCACTGCAAC
CGGATGGAGCAGGACACGAGCCACCTGGACGACTGGGCCTTCCTGGCCTACAGGTGCGCC
ACTTCCGGGCAGTTTGGCCATTGGGTCAAGGACTTCATGAGTCAAAAGGAAGTGGAACGA
TGA
> CG13429 Obp57e. I agree with Hugh Roberston and Galindo & Smith that the 5'
exon was
> missed and the 3' exon does not exist as indicated in the original prediction.
> 5' end-GCTGGATCCGTATGTTGGACCAACTTACAC 3' end-GTTTCAATTAGTAATGCAAAGTAGCTCGAGAGG
ATGTTGGACCAACTTACACTGTGTTTGTTGCTAAATTTTCTGTGCGCAAATG
TTCTCGCTAACACTTCAGTATTTAATCCGTGTGTTTCGCAAAATGAGTTATCCGAATATG
AAGCCCACCAAGTGATGGAGAATTGGCCAGTTCCGCCCATCGATCGGGCTTACAAATGCT
TTCTAACTTGCGTCCTTTTGGATTTGGGCCTGATTGATGAACGGGGTAATGTGCAGATCG
ATAAGTACATGAAATCCGGAGTGGTGGACTGGCAATGGGTGGCAATAGAGTTGGTAACAT
GTCGCATAGAATTCAGCGACGAAAGGGATCTGTGCGAGCTATCATATGGAATCTTCAACT
GCTTCAAGGATGTGAAGCTTGCGGCCGAGAAGTATGTTTCAATTAGTAATGCAAAGTAG
> CG13874 Obp56h. I agree with Galindo and Smith & Robertson that the 5'
signal-peptide
> encoding exon was missed. 5' end-gagggatcctcaaaatgaagttcaccct,
> 3'end-acatcactaatgcctgatcctcgaggtg
ATGAAGTTCACCCTATTCTGTATTGCTCTGGCAGCTTTTTTGTCCATGG
GACAGTGTAATCCGGACTTTCGCCAAATAATGCAACAGTGCATGGAGACCAACCAAGTGA
CCGAGGCTGATCTCAAGGAGTTCATGGCCAGCGGGATGCAGAGCAGTGCCAAGGAGAACC
TCAAGTGCTACACCAAGTGCCTGATGGAGAAGCAGGGTCATCTCACCAATGGCCAGTTCA
ATGCACAGGCTATGCTCGACACTCTCAAAAATGTGCCTCAGATCAAGGACAAAATGGACG
AGATTTCCTCGGGAGTGAATGCCTGCAAGGACATCAAGGGAACCAACGATTGCGACACGG
CCTTTAAGGTTACCATGTGCCTGAAGGAGCACAAGGCCATTCCAGGACATCACTAA
> CG13873 Obp56g. I agree with Galindo & Smith and Robertson that the 5'
signal-peptide
> encoding exon was missed. Two splice donor sites are predicted 3 bases apart.
> Our transcript was spliced at the earlier (somewhat lower scoring) site, so
the protein
> encoded by our cDNA is one a.a. longer than that predicted by Hugh Robertson.
> 5'end-gtcggatccatgagggctacattcgcattg 3'end-caggcagccaattagggtctctcgagtcc
ATGAGGGCTACATTCGCATTGACTCTGTTGCTCGGCTGCCTTTCAGGAATTTTG
GCGCAGCAAGCCAACATAGACAGTTCGGTGTCCAAGGAACTGGTGACGGATTGCCTCAAG
GAGAACGGTGTCACTCCCCAGGATCTGGCTGACTTGCAATCGGGCAAGGTGAAGGCCGAG
GATGCCAAGGACAATGTGAAGTGCTCCTCACAGTGCATTCTGGTCAAGAGCGGTTTCATG
GACTCCACTGGCAAACTGCTGACCGACAAGATTAAGTCTTACTATGCGAACTCGAACTTT
AAGGATGTCATCGAAAAGGATTTGGACAGGTGTAGCGCGGTCAAGGGGGCCAATGCCTGT
GACACTGCCTTCAAGATATTATCCTGCTTCCAGGCAGCCAATTAG
> FBgn0043532 Obp56i. I agree with both Robertson and Galindo & Smith that
there is a gene
> here (not originally predicted) and our cDNA matches their predictions. I
have submitted
> the cDNA sequence to genbank (AF457143) and release was requested on May
30th (still
> pending). 5'end-GCTGGATCCTACCCTGCTGAAAAATGCAT
3'end-CGAAATCACAGAGGATAAAGTCTCGAGTCC
ATGCATTTTTTCGCCTGCTGTGCATTATTGTTAGTCGTCG
TTACTTTACCAACATGTTTCGTACAAGCAGGTCCCATTAAGGATCAATGCATGGCGGCGG
CGGGCATCACAGCACAAGATGTTGCGAATCGTCATGAGACCGACGACCCTGGCCATAGTG
TCAAGTGCTTTTTCCGCTGTTTTCTAGAAAACATTGGCATTATCGCCGATAACCAGATAA
TACCCGGTGCTTTTGACCGAGTTCTAGGCCATATAGTTACCGCGGAAGCCGTAGAGCGAA
TGGAAGCGACGTGTAATATGATTAAGAGCGAGACAACCTATGACGAGTCTTGTGAATTCG
CCTGGCAAATCTCCGAGTGCTACGAAGGAGTAAGATTATCAGATGTTAAGAAGGGCCAAA
GAACTCGAAATCACAGAGGATAA
> FBgn0043536 Obp57d. I agree with both Robertson and Galindo & Smith that
there is a gene
> here (not originally predicted) and our cDNA matches their predictions. I
have submitted
> the cDNA sequence to genbank (AF457149) and release was requested on May
30th (still
> pending). There is some uncertainty as to the initiator Met. The others
have predicted
> a start at the second ATG in this sequence. Our primer location does not
unequivocally
> differentiate between the two as is contains 15 nt which lie between these
two ATGs.
> 5'end-AGCGGATCCTATGATATCTTCAACTAGT 3'end-GTCATAAAAGCCGTTGTAAAGACTCGAGCCT
ATGATATCTTCAACTAGTTTGATGCCTGAAAAAATGTCTCTAAGACTCATACC
GCATCTGGCTTGTATTATTTTTATTTTGGAAATTCAGTTTAGAATTGCCGATTCTAACGA
TCCGTGCCCCCATAATCAAGGAATAGACGAAGATATAGCCGAATCAATTCTAGGTGACTG
GCCTGCAAATGTGGATTTGATTAGCGTGAAAAGGTCCCACAAGTGTTATGTGACCTGCAT
TTTGCAATATTACAATATTGTGACCACTTCTGGTGAGATATTTCTGAACAAATACTACGA
TACTGGAGTCATTGATGAATTGGCGGTGGCACCCAAAATCAATCGATGCCGATATGAGTT
TAGAATGGAAACAGATTATTGTAGCCGAATTTTTGCTATATTCAATTGTTTAAGGCAAGA
AATATTAACAAAGTCATAA
> FBgn0043534 Obp57b. I agree with both Robertson and Galindo & Smith that
there is a gene
> here (not originally predicted) and our cDNA matches their predictions. I
have submitted
> the cDNA sequence to genbank (AF457147) and release was requested on May
30th (still
> pending). 5'end-actggatcctacaatgttcatctacagac
3'end-cgtaattgattcggaataaatgctcgagagg
ATGTTCATCTACAGACTTGTATTTATTGCGCCTCTGATTTTGTTATTGTT
CAGCTTGGCCAAGGCTCGCCACCCCTTTGATATATTTCATTGGAATTGGCAAGACTTTCA
GGAGTGTCTACAAGTTAATAATATTACCATAGGAGAATATGAGAAATACGCGCGACACGA
AACTTTGGATTACCTGCTCAACGAGAAAGTCGACTTGAGGTACAAGTGCAATATTAAATG
TCAGCTGGAAAGGGATTCAACGAAATGGTTGAATGCTCAAGGCAGAATGGATTTGGATTT
GATGAATACCACCGATAAGGCATCCAAATCCATTACCAAGTGCATGGAGAAGGCTCCCGA
AGAACTTTGTGCGTACAGTTTTAGACTGGTGATGTGTGCATTTAAGGCCGGCCATCCGGT
AATTGATTCGGAATAA
> FBgn0043535 Obp57a. I agree with both Robertson and Galindo & Smith that
there is a gene
> here (not originally predicted) and our cDNA matches their predictions. I
have submitted
> the cDNA sequence to genbank (AF457148) and release was requested on May
30th (still
> pending). 5'end-actggatccaatgttcaacactagacttgc
3'end-gattacgataccatcgatttataactcgagagg
ATGTTCAACACTA
GACTTGCCATTTTTTTGCTTCTTATCGTTGTTTCGCTTAGCCAAGCTAAGGAAAGCCAAC
CCTTTGACTTTTTCGAAGGAACCTATGACGATTTTATTGATTGTCTGAGAATCAATAATA
TTACCATTGAAGAGTATGAGAAGTTTGACGATACCGACAATTTGGATAATGTCCTCAAGG
AAAATGTCGAACTGAAGCACAAGTGCAACATTAAGTGTCAACTGGAAAGAGAGCCAACCA
AATGGCTAAATGCTCGGGGTGAAGTCGATCTGAAATCAATGAAAGCAACCAGTGAGACAG
CGGTATCCATATCAAAGTGCATGGAGAAGGCTCCCCAAGAAACCTGTGCCTACGTCTATA
AATTGGTAATATGTGCATTCAAATCCGGACATTCAGTCATCAAGTTCGATTCATATGAAC
AAATACAAGAGGAAACCGCTGGACTAATAGCTGAACAGCAGGCGGATCTGTTTGATTACG
ATACCATCGATTTATAA
> FBgn0043533 Obp56f. I agree with both Robertson and Galindo & Smith that
there is a gene
> here (not originally predicted) and our cDNA matches their predictions. I
have submitted
> the cDNA sequence to genbank (AF457146) and release was requested on May
30th (still
> pending). 5'end-actggatcctatgaaagtattcctgttgttc
3'end-CCATTACCAAGCATTAGACTTCTCGAGACT
ATGAAAGTATTCCTGTTGTTCATTTTCATCTCTGCTATCTGGCTCCAAGCATTTTGTATG
AAATCTTCTGAAAAAATAAAAGCCTGCTTGAAACGGCAGCTGGGGTATA
CAATTACAGAAAATACAAAATTTGATGCTAAAGAAGACTCTCTTCAAAGCAAGTGTTTTT
ATCACTGCTTACTGGAAGTGAAAGGTGTTATTGCAAATGATGCGATCAGTTCGGAGCAAC
CGAGGAAAGTACTTGAAAAAAAGTATGGCATTACTGACACAGATGAATTGGAAAAGGCTG
AAGAAAAGTGTCATTCCATCAAGGCTTCAGGAAAATGTGAATTGGGCTACGAAATCTTGA
AATGCTATCAGTCCATTACCAAGCATTAG
> CG12944 Obp47a. I agree with Robertson and Galindo & Smith that the
initiator Met is
> earlier than originally predicted. However, I agree with the original
prediction of the
> splice acceptor site which lies 15 nt further downstream than that predicted
by Robertson
> and Galindo & Smith. However, there were 7 polymorphisms relative to the
Celera
> sequence, so we amplified the genomic sequence as well. The polymorphisms
were confirmed
> and the intron sequence had numerous additional polymorphisms which could
potentially
> result in use of an earlier junction (end of lowercase on bottom line) in
the strain
> sequenced by Celera. This is the intron alignment.
> Canton-S (Mine)
gtgagtttgggttcaaaaaacaag----caaagggatttgcttataaaagcacctcttttcttcag
> ::::::::::::: :::::: :: ::: ::::::::::::::::::::: ::::
 : ::::
> Celera
gtgagtttgggttaaaaaaaaaaaaaaacaatgggatttgcttataaaagCACATCTTCT-GTCAG
> 5'end-GAGTCTAGAAATGAATCGAGTTCTAGTGC 3'end-CTTAGAACTTTGCACAACACTCGAGGTG
ATGAATCGAGTTCTAGTGCTATTGCTGGTGCTTAAAATGTTCGCTTTGAGCGAGTCCCGT
TTCGCCAAGATAAACATCAATCTGGGACTAACCGTTGCTGATGAATCCCCCAAAACGATC
ACCGAGGAAATGATTCGCCTGTGCGGAGATCAAACGGATATATCCCTCAGGGAGTTGCAC
AAGCTGCAAAGGGAGGACTTTTCGGATCCCTCGGAATCCGTCCAGTGTTTCACCCATTGC
CTCTACGAGCAAATGGGTCTCATGCACGATGGTGTTTTTGTGGAACGCGATCTATTCGGG
CTTCTTTCCGATGTCAGTAATCCCGATTACTGGCCAGAACGTCAATGCCACGCGATTCGT
GGCAATAACAAATGTGAGACGGCCTACAGGATTCATCAATGCCAACAGCAGTTGAAACAA
CAGCAAAAGAACTTATTGGCCACCAAGGAGGTTGAGGTCACCACCACACCAGCTGGATCC
GATGAAACAAAACCTTAG
> FBgn0043530 Obp51a. I agree with both Robertson and Galindo & Smith that
there is a gene
> here (not originally predicted) and our cDNA matches their predictions. I
have submitted
> the cDNA sequence to genbank (AF457145) and release was requested on May
30th (still
> pending). 5'end-atcggatccagtattcattggcctggttc
3'end-cttgtaaaattgtatctgaacctcgagagg
ATGAAAGTATTCATTGGCCTGGTTCTGTTGTTAGCTGTCACTACGCTGTCATCCGCTTT
ATTCGAATCTGAAGCGAACGAATGTGCTAAAAAGCTGGGAATTACCCCAGATTACTTCGA
AAATTTTCCGCACAGCAGTCGGGTGAAGTGCTTTTACCACTGCCAAATGGAAAAACTTGA
AATAATTGCCAATGGTGTGGTAACACCATTCGATTTGAAAGTATTGAACATATCACCGGA
GAGCTATGATAAGTATGGTGTAAAGGTAAAACCATGCCTCAAACTATCGCATCGCGACAA
ATGTGAGCTCGGTTACTTGGTGTTCCAGTGCTTGAAACGAGAATTCAACTTGTAA
> CG15129 Obp56b. I agree with both Robertson and Galindo & Smith that the
original
> prediction has fused two separate OBP genes. I was not able to amplify a cDNA
> corresponding to the prediction although I did amplify the cDNA for each OBP
> individually (second one below). My cDNA matches the prediction of
Robertson and
> Galindo & Smith.
> 5'end-GAGGGATCCGAATGTAGCTTTGGAAAGATG 3'end-GTTAAGGGTATTAGTGCCTAACTCGAGGTG
ATGAAACTTATCTACTTGTTGGTTGTATTCCTAATT
TTCGCTCTAAGCGAACTAGTAGCGGGCCAGTCAGCTGCGGAATTGGCAGCCTACAAGCAA
ATTCAACAAGCCTGCATCAAGGAGCTGAATATTGCTGCCAGTGATGCTAATTTGCTGACC
ACCGACAAGGAGGTGGCGAATCCCTCTGAGTCGGTGAAGTGCTATCACAGCTGCGTCTAC
AAGAAACTGGGTCTCCTGGGTGACGATGGAAAGCCCAATACTGATAAGATCGTTAAGTTG
GCCCAGATCCGTTTCAGCAGTCTGCCGGTGGATAAGCTAAAGAGTTTGCTTACCAGCTGC
GGAACCACAAAGTCAGCCGCCACCTGTGACTTTGTCTACAACTATGAAAAGTGTGTTGTT
AAGGGTATTAGTGCCTAA
> CG15129 Obp56c. Second OBP in fused prediction. Differed from predictions
of Robertson
> and Galindo & Smith in that we did not observe a second intron. Therefore,
in addition
> to having longer than usual N and C termini, this isoform also contains an
insertion of
> about 40 a.a.. Galindo & Smith also predicted a different 5' signal peptide.
Original
> gene prediction, although fused upstream of Obp56b, includes the observed
signal peptide
> (predicted start codon 21 nt downstream of actual start) but not the second
intron.
> 5'end-GAGGGATCCTTAGATGTATTTTCGAGCCAG 3'end-GCTAAGTCGGAGTAAATAGCTCGAGGTG
ATGTATTTTCGAGCCAGTTTGATGGCATTGCTTTGCCTCACTCTTAGTGAATTCGTTTCT
AAAGCATGGACCCGATCGCTTTCCGTCTCGCTGAACATGTCGATGACACGAACCCTGGTT
CCAGATCCGCTAAATGGAACAGAAAACAAACTCAGCCAGGAGATGCTGAGGGCTTGTATG
CGTAGGACCGAGATCTCAATGTCGCAACTGAAACTATTTCACATGAGCCTGATGAACAGC
GACTACAATAATGACAACGATATAGCCCCTACGCCAGTTCAATCCATTGGCGATGTAAAT
AACCTGGGTGATCTGGACTTCAATGGCAACTCGCAGATGCCCTATCTCGATCTGAAGCAT
AATGAGCCGCTGCAGTGCTTTGTGAGCTGTCTGTATGAGACCCTGGATTTGGATAGGTAC
AATGTCCTGCTGGAGGAGGCCTTTAAGAATCAGGTGCAAACGATCATACAGCATGAGAAG
GCGGAGATCAAGGAGTGTAGTGATCTTCAGGGCAAAACACGATGCGAGGCAGCCTACAAG
CTGCACCTGTGCTACAATCACCTGAAAACTCTGGAGGCGGAGCAGCGTATCCGTGAGATA
CTTGAGCGGACCGAGGCGGAGAACGAAGGATTCGGTCCGGAGGGCAGCGACTTTATCGAC
GGCATCCAGCATTCCGGAGAAGCAATGACCACCGCTAAGTCGGAGTAA
> FBgn0043539 Obp22a. I agree with both Robertson and Galindo & Smith that
there is a
> gene here (not originally predicted). Our cDNA did not contain the second
intron that
> they predicted. We designed three primers to test three possible scenarios;
that there
> is no intron at the 3' end, that there is a short intron as predicted by the
others,
> or that there is a longer intron. All three possibilities introduce only a
small number
> of a.a. to the C terminus of the protein, so the actual transcript was
difficult to
> predict. We only obtained the cDNA corresponding to the no 3' intron
version. I have
> submitted the cDNA sequence to genbank (AF457144) and release was requested
on May 30th
> (still pending). This isoform has a small internal deletion of about 12
a.a. relative
> to other OBPs.
> 5'end-actggatccttcgagatgcgagtgttgct 3'end-ggatagatagaggatagagtctcgagcgt
ATGCGAGTGTTGCTGGCTTTTGTACTTCTGCTTGGCCTCTCAGTTTTG
GCCACTAAGGAACCGGAAGAAGTTAAAATTGTAAGCGAGTGTGCCAAGGAGAACAATGTT
CATAGGAAGAAGGCACTGGACCTTTTAATGAGCTATCGTTTGAAGAAGAAAACCCACAAC
GTCATGTGCTTCATCAACTGCATCTTCGAGCGAACCAACATACTGCAGAAAGTTAAGGAA
AAGGTTGTAAAGGAAAATCACAACTGCGACTCCATCAAGGACGCTGATAAGTGTGCAGAA
TCCTTCCAAAAATTTCAATGCTTGGTCAAGATTGAGATGAAAGTGAGGGGGATAGATAGA
GGATAG
> CG11797 Obp56a. There are 18 ESTs (several which appear not to be the same
> clone resequenced) which confirm the original gene prediction.
> See gi|15481152|gb|BI589730.1|BI589730 for example.
> CG13421 Obp57c. There are 2 ESTs which confirm the original gene prediction.
> gi|15523123|gb|BI627598.1|BI627598
> CG2297 We propose the name Obp44a. This is a four-Cys isoform. There are 87
ESTs which
> confirm the original gene prediction. gi|15531140|gb|BI628930.1|BI628930
> CG11218 Obp56d. There are 24 ESTs which confirm the original gene prediction.
> gi|15484370|gb|BI592948.1|BI592948
> CG1670 Obp19b. There are 10 ESTs, several of which appear to be independent
clones,
> which determine the coding sequence to be as below. The initiator Met is
downstream
> of that originally predicted but upstream of that predicted by either
Robertson or
> Galindo & Smith.
> See gi|15532575|gb|BI630365.1|BI630365 or gi|3833396|gb|AI238538.1|AI238538.
atgatgcagtg cagccgaatg acgacgacgt tgaagatgac gaaccttctg ctagcagtgg
cctgcgccgc cgtgctgatg ggatcggcga cggcggacga ggaggagggg tccatgaccg
tggacgaggt ggtggagctg atcgagccct ttggcgacgc ctgcacgcca aagccgtcga
gggagaacat cgtcgagatg gtgctgaaca aggaggacgc caagcacgag accaagtgct
tccgccactg catgctggag cagttcgagc tgatgcccga ggatcagttg cagtataacg
aggacaagac ggtcgatatg atcaacatga tgttcccgga tcgcgaggac gacggcaggc
gcatcgtcaa gacctgcaac gaggagctaa aggccgagca ggacaagtgc gaggcagccc
acgggatcgc tatgtgcatg ctgcgcgaga tgcgctcttc gggcttcaag attcccgaga
tcaaggaatg a
> CG8462 Obp56e. There are 24 ESTs which confirm the original gene prediction.
> gi|15531268|gb|BI629058.1|BI629058
> CG18111 Obp99a. I agree with Robertson and Galindo & Smith that the first
exon was not
> identified in the original gene prediction. I don't understand why the
intron report of
> Steve Mount is here as the gene was not originally predicted to have an
intron. However,
> the intron in his report is definitely the actual one but with incorrect
ends. There
> are 15 ESTs, of which several were independently obtained, which confirm the
following
> coding sequence. See gi|15506074|gb|BI610549.1|BI610549,
> gi|13692677|gb|BF500840.2|BF500840
atgaaggtt ttcgttgcca
tctgcgtgct gattggactg gcctccgccg actatgtggt gaagaaccga cacgacatgc
tggcctaccg cgatgagtgc gtcaaggagc tggccgtgcc cgtggatctg gtggagaagt
accagaagtg ggagtacccc aacgacgcca agacccagtg ctacatcaag tgcgtcttca
ccaagtgggg cctgttcgac gtccagagcg gtttcaacgt ggagaacatc caccaacagc
tggtgggcaa ccacgctgac cacaacgagg ccttccacgc ctccttggcc gcctgcgtgg
acaagaacga gcagggatcc aatgcctgcg agtgggccta ccgcggagcc acctgtctgc
tgaaggagaa cctggcccag atccagaaga gcctggcccc gaaggcctag
> CG12665 We propose the name Obp8a. I agree completely with Robertson that
the first
> exon was not identified in the original gene prediction. This is another
4-Cys isoform.
> There are four ESTs confirming the following coding sequence.
> See gi|4247802|gb|AI404715.1|AI404715 (orientation backwards).
ATGATGCGGAGATCACAGATCGGTTTGCTCAGCAGGCTGCTGCTGTTGCTGCTGGTGGTGGAACTGACGC
CCCCTGCTATTCCGGTGCCCATGCGATCCTCACCCCAATCGCTGGCCCTACTGCGAGCACGGGATCAGTG
CGGCAGGGAGCTGACTGCTGCCCAGCGTCTGCAGCTGGACAGGATGCAATTCGAGGATGCTGCCCATGTG
CGTCACTATCTCCATTGCTTCTGGTCACGGCTGCAGCTCTGGCTGGATGAGACCGGATTCCAGGCACAGC
GCATCGTTCAGAGTTTCGGCGGCGAGAGGCGTCTCAATGTGGAGCAGGCACTGCCAGCCATCAACGGGTG
CAATGCGAAAACGAGCTCCAGAGGATCGGGCGCTCAGACAGTGGTCGACTGGTGTTTCCGTGCCTTTGTC
TGCGTGCTGGCCACTCCAGTCGGTGAGTGGTACAAGCGCCACATGTCCGATGTCATCAATGGGAATGCCTAG
> CG7584 We propose the name Obp99c. This is another 4-Cys isoform. The
original gene
> prediction is confirmed by 36 ESTs. See gi|15521987|gb|BI626462.1|BI626462.
> CG7592 Obp99b. The original gene prediction is confirmed by 12 ESTs.
> See gi|3868657|gb|AI261132.1|AI261132I261132
Dr. Laurie Graham
Department of Biochemistry
Queen's University
Kingston, Ontario
K7L 3N6
PH: 613-533-2984
FAX: 613-533-2497
grahamla@XXXX
DOI
Associated Information
Comments
Associated Files
Other Information
Secondary IDs
    Language of Publication
    English
    Additional Languages of Abstract
    Parent Publication
    Publication Type
    Abbreviation
    Title
    ISBN/ISSN
    Data From Reference