Reference Report
| Reference | |||
|---|---|---|---|
| Citation | Schaefer, U. (2003.12.4). Gottingen X chromosome P{lacW} insertion line questions. (Export to RIS) | ||
| FlyBase ID | FBrf0173177 | ||
| Publication Type | Personal communication to FlyBase | ||
| PubMed ID | |||
| PubMed Abstract | |||
| Text of Personal Communication |
To: uschaef@XXXXXXXXXXXXXXX
Subject: FlyBase query: Gottingen P-element lines From: Gillian Millburn (Genetics) <gm119@XXXXXXXXXXXXXXX> Date: Wed, 3 Dec 2003 17:59:45 \+0000 Dear Dr. Schaefer, I am a curator working for FlyBase. I am curating the supplementary information from your paper Peter et al., 2002, EMBO Rpts 3(1): 34--38 which contains the information about all the Gottingen X chromosome P{lacW} insertion lines to get the information into the database and I have a few questions to try and clarify what is going on in a few of the lines. I got the supplementary information as a table from: ftp://ftp.ebi.ac.uk/pub/databases/edgp/200111/PX-lines.txt the format for each P-element line in the above file is as follows: and I have just copied the line relevant to each particular P-insertion in the questions I have that follow. I am sorry there are several questions, I have tried to organise them into similar categories to make it easier. Any extra information you can give me about these lines would be very useful and I would record the information as a personal communication from you to FlyBase. 1. viable lines. The following lines are listed as viable in the supplementary information, but we already have a record of them in FlyBase as lethal genes \+ alleles. My question for these is, in each case, is there any lethality in the strain or are the flies homozygous viable ? If the flies are homozygous viable I will remove the lethal alleles from FlyBase and will just make insertion records to store the information like the accession number and the affected gene. If there is some homozygous lethality in the strain, does this mean that in each case the lethality is separable from the insertion ? The lines are: l(1)G0500,AJ300032,12282,2C2,2C1-2,east,viable l(1)G0123,AJ426927,11885,13E3-8,13E1-6,sog,viable l(1)G0104,AJ427038,11817,,12D,yoyo,viable l(1)G0398,AJ427047,11909,,12C,yoyo,viable l(1)G0250,AJ426807,11925,8D10-12,8E1-8,CG17251,viable l(1)G0346,AJ426808,11929,8D10-12,8E1-4,CG17251,viable l(1)G0400,AJ426812,12006,8F3-5,(3A1-4 &) 8F,CG15321,viable l(1)G0230,AJ426821,11955,9B6-7,9B1-8,CG2968,viable l(1)G0444,AJ426867,12049,10C4-5,10C1-2,CG1558,viable l(1)G0185,AJ426901,12153,12D4-E1,12E5-7,CG11595,viable l(1)G0225,AJ427021,12231,18F1-2,18F,CG12701,viable l(1)G0094a,AJ426682,11811,4C8,4D1-2,ctp,viable l(1)G0094b,AJ426841,11811,9E2-4,9E3-4,ras,viable 2. discrepancies between cytology and sequence localisation a. In the following lines there is a discrepancy between the 'LOCALIZATION' (determined molecularly) and the 'IN SITU HYBRIDIZATION' localisation. In each case, could you tell me whether you think that this means that there are actually 2 inserts \- one defined by the accession number and one defined by the in situ hybridisation, or whether you think there is just one insertion and there is an error in the in situ value. The lines are: l(1)G0031,AJ299996,,1B5-6,12C,elav,E l(1)G0024,AJ300007,11496,1D1,3B,BACR7A4.15,L3 l(1)G0015,AJ300074,,3C7,2C7-8,N,E l(1)G0449,AJ426694,10104,5C5-6,4D4-6,Act5C,'L3, short L3s' l(1)G0182,AJ426748,11950,7A4,12A1-2,brk,E l(1)G0327,AJ426757,12292,7C8-D1,1B7-10,CG2206,L1-L2 l(1)G0238,AJ426839,11957,9E2-4,7E3-6,ras,fl l(1)G0141,AJ426868,10148,10C6-7,11A7-8,CG1703,'L3-pP-P-pA-A, short bristles, ms' l(1)G0476,AJ426910,10127,12D4-E1,13E1-4,CG1405,L3-pP l(1)G0285,AJ426999,11965,18D8-11,19E,CG12238,fs l(1)G0196,AJ427035,11872,19F6-20A1,9E1-4,CG14616,L1-L2 l(1)G0270,AJ426818,11873,8F3-5,9E4-10,CG15321,P-pA l(1)G0473,AJ426952,10125,14B9-12,11B1-4,CG3415/katanin-80,fs b. the following 2 lines also show a discrepancy between the cytology and sequence localisation, and in addition they are also listed as viable: l(1)G0495,AJ426760,12280,7D5-6,12C,fs(1)h,viable l(1)G0060,AJ426693,11653,5B2-5,11B1,CG3125,viable for these, could you tell me whether you think that this means that there are actually 2 inserts \- one defined by the accession number and one defined by the in situ hybridisation, or whether you think there is just one insertion and there is an error in the in situ value. In addition, are these lines homozygous viable or is there a separable lethality somewhere in the strain (like question 1.) 3. l(1)G0459,AJ427049,12260,,3A & 10E-F,yoyo,fs By BLAST, the AJ427049 sequence given for this line is in the gene c12.1 and is identical to the sequence given in accession record AJ426806 \- is the sequence in AJ427049 a mistake ? here is the sequence I got from EMBL for AJ427049: >embl|AJ427049|DME427049 Drosophila melanogaster X chromosomal sequences flanking P-lacW insertion, strain l(1)G0459 gtactgttgatacatcaaacaaagcacgcagttcggaaattcatttctcttttcattaat ttaacaattaaacgcataactagctagttgaaaatgaccacagcagcgc Also, in a previous personal communication to FlyBase (FBrf0125103, date:1999.12.2) you gave the in situ localisation for l(1)G0459 as 7D Could you tell me which in situ localisation is correct \- 3A & 10E-F as given in the supplementary info, or 7D as in FBrf0125103. 4. l(1)G0396,AJ426858,,10B8,10B1-2,KAP3,'pA, die at hatching' I just wanted to check that the 'KAP3' mentioned in your abstracts: Peter et al., 1999, Europ. Dros. Res. Conf. 16: 264'Characterization of a gene encoding the kinesin associated protein 3 (KAP3) in Drosophila melanogaster.' and Pflanz et al., 2001, Europ. Dros. Res. Conf. 17: O4'Functional analysis of the kinesin-associated protein KAP3.' is the same gene as the one affected in the l(1)G0396 strain. 5. l(1)G0252,AJ426889,11880,11D5-6,11C,lic,'semilethal, m & f' The sequence of AJ426889 at EMBL is identical to AJ426848 and does not map to lic in 11C but maps by BLAST to region 9 cytologically in sesB/Ant2 \- has there been a mistake in the sequence in AJ426889 ? here is the sequence I got from EMBL of AJ426889:>embl|AJ426889|DME426889 Drosophila melanogaster X chromosomal sequences flanking P-lacW insertion, strain l(1)G0252 atagcccatttaacaaaanacgngngtggttccaaangcttttattaatanttttttttt ttaaatcaaatccaacctgagcattgaaagaaaatctgcctggttatgtaaaacaacaaa agagttgaacttgaatcattcattgaacaattttttttntggtgtgtggtggtggtctta tgcaatcaatacncaatgaattaagaataatcttaacactggattgtggatacanctaag gctgttcagccttcggtggaagctttccacgtgcaactgtagaatttttccagctgaggc tattacatcacgagccntttagctatnggctctntgnggctgtggccgaagaaaaagctt cactctctttccagccaatcaaaagtctaacacgattagataacggttgttatttcaaag aaagagaacanaagagnagcgaancaatggcaaagcccagttctctttgccaagtgtgtt acataaaacccttgtcaatgaaatgctgatttaatttcgctaaaatattttttaaaccac gcggctaacgcagagcggcggcatgctcttgaaagtctaaaattaacaatacgcgc 6. the sequence in the two accession number AJ427025 (l(1)G0004 ) and AJ427026 (l(1)G0005) are identical \- is this correct ? here are the sequences I got from EMBL: >embl|AJ427025|DME427025 Drosophila melanogaster X chromosomal sequences flanking P-lacW insertion, strain l(1)G0004 gatcccagcacctggccctcaatgccggtcgcctcatccacctgcatctccacgtcctgc tgcccgcctccgctggctccgcgcttcgtcgctctcttcgccggctcgaatgcgtctgct c >embl|AJ427026|DME427026 Drosophila melanogaster X chromosomal sequences flanking P-lacW insertion, strain l(1)G0005 gatcccagcacctggccctcaatgccggtcgcctcatccacctgcatctccacgtcctgc tgcccgcctccgctggctccgcgcttcgtcgctctcttcgccggctcgaatgcgtctgct c 7. l(1)G0001,,,,nd (P-GawB!),yoyo,E I just wanted to check that this strain contains a GawB insertion instead of a lacW ?! 8. l(1)G0460a,AJ300082,,3C7,nd,N,E l(1)G0460b,AJ426801,,8B4-7,8B3-7,Moe,E the sequences given in AJ300082 and AJ426801 are identical and both map to Moe in 8B. Is there are mistake with AJ300082 as it is said to map to 3C in N ? here are the sequences I got from EMBL:>embl|AJ300082|DME300082 Drosophila melanogaster X chromosomal sequence flanking P-lacW insertion strain l(1)G0460a gcgtcggcttttcatttttcgttcatttatttattttcctctccagtttttttttttttt tttgggtgcaacaagtgtgcggcgctttgttgtttttgtaccgttttttatgttaattaa ccaaaacgagttgttgttcgtgtgtttgctatgcttgactagttaagcgcgtagagagca aaagagatggagagggagcgaacgaaagagagaggaagaaagatcattacgtaatgggga aaacgttgctttcaaattctccagtgttgccaccttatcaaaatgacacttgttacgctc cgcgacccctttttaacccttttccattgcttatttaaaaatttaaattaaacatttttt atgaaaatttcaaaagttttcctattcacctgtttttttagtggtcaaaacattttatgc caacgtgaattggcaatactggttgttaagccgcgtgactcgtttttttttttgaccgca cataaaattcaaatttttgttgtttgtttaccgatcatcttgcattctctcgctcgcttt tatttctctctgtttgcatttcgttttgactccttctttggccttactcatttgatttcg gacgcttgagacgtgcgcttttcgcagcaatcgcatcgaaagaagagagcaaggagttgc gagggagagatgaagtgaccgaaagagagagtcaaaagagagtagacttttcttctagaa accacgatgccttttaataaatcatagttttccaagtgagtaattttaaccccgccttca cccaattattcaaatgcagcggngccgagaaaaaattatattgtnaatgccatgggtcaa aaaaaaaagctgc >embl|AJ426801|DME426801 Drosophila melanogaster X chromosomal sequences flanking P-lacW insertion, strain l(1)G0460b gcgtcggcttttcatttttcgttcatttatttattttcctctccagtttttttttttttt tttgggtgcaacaagtgtgcggcgctttgttgtttttgtaccgttttttatgttaattaa ccaaaacgagttgttgttcgtgtgtttgctatgcttgactagttaagcgcgtagagagca aaagagatggagagggagcgaacgaaagagagaggaagaaagatcattacgtaatgggga aaacgttgctttcaaattctccagtgttgccaccttatcaaaatgacacttgttacgctc cgcgacccctttttaacccttttccattgcttatttaaaaatttaaattaaacatttttt atgaaaatttcaaaagttttcctattcacctgtttttttagtggtcaaaacattttatgc caacgtgaattggcaatactggttgttaagccgcgtgactcgtttttttttttgaccgca cataaaattcaaatttttgttgtttgtttaccgatcatcttgcattctctcgctcgcttt tatttctctctgtttgcatttcgttttgactccttctttggccttactcatttgatttcg gacgcttgagacgtgcgcttttcgcagcaatcgcatcgaaagaagagagcaaggagttgc gagggagagatgaagtgaccgaaagagagagtcaaaagagagtagacttttcttctagaa accacgatgccttttaataaatcatagttttccaagtgagtaattttaaccccgccttca cccaattattcaaatgcagcggngccgagaaaaaattatattgtnaatgccatgggtcaa aaaaaaaagctgc that's it, sorry there are so many questions \! Gillian \-------------------------------------------------------------- Gillian Millburn. FlyBase (Cambridge), Department of Genetics, University of Cambridge, Downing Street, email: gm119@XXXXXXXXXXXXXXX Cambridge, CB2 3EH, Ph : 01223-333963 UK. FAX: 01223-333992 FlyBase: http://fbserver.gen.cam.ac.uk/ \-------------------------------------------------------------- Date: Thu, 4 Dec 2003 11:33:07 \+0100 To: Gillian Millburn (Genetics) <gm119@XXXXXXXXXXXXXXX> From: Ulrich Schaefer <uschaef@XXXXXXXXXXXXXXX> Subject: Re: FlyBase query: Gottingen P-element lines Dear Gillian, thank you for your e-mail and particularly for the effort in sieving through our data on those lethal lines. ... I will go through all your questions in the order you mailed me and I will answer them and correct any errors. 1. The P insertion lines were kept if the insertion caused lethality (few escapers <1% compared to their FM7c brothers that were already clearly affected in their viability) or semilethality (<20% of FM7c brothers). I did a quantitative recheck of the lethal effect after the final establishing of the lines. In addition, Peter Deak in David Glover's lab screened our lines for the timepoint of lethality and his data are incorporated in the table. The label 'viable' just points out that adult flies eclosed in his analysis even when I could find none or only a few escapers as listed below. l(1)G0500: semilethal (<20% of FM7c control) l(1)G0123: semilethal (<10% of FM7c control) l(1)G0104: semilethal (<10% of FM7c control) l(1)G0398: semilethal (<5% of FM7c control) l(1)G0250: semilethal (<10% of FM7c control) l(1)G0346: semilethal (<5% of FM7c control) l(1)G0400: lethal (<1% of FM7c control), no escapers in my hands l(1)G0230: lethal (<1% of FM7c control), no escapers in my hands l(1)G0444: semilethal (<20% of FM7c control) l(1)G0185: lethal (<1% of FM7c control), no escapers in my hands l(1)G0225: lethal (<1% of FM7c control) l(1)G0094a,l(1)G0094b: semiviable (<50% of FM7c control), faint bristles and female sterile In addition, I should point out that Timothy Karr (University of Bath) has detected Wolbachia in most of our strains and that the strength of this bacterial infection might influence the vitality of the flies. 2. a) Although there is no final proof available we have no evidence for another site as indicated by the in situ hybridisation. Hence, everything is in favor that the molecular localisation is correct and that the in situs are misinterpreted. b) Same answer as in 2a). With regard to the viability here are my data (also seen in the background of 1) l(1)G0495: lethal (<1% of FM7c control) l(1)G0060: lethal (<1% of FM7c control), no escapers in my hands 3. My fault. I did submit the same sequence twice as you suggested. The correct sequence for l(1)G0459 follows. It is derived from 5' and 3' inverse PCR and has the P insertion at position 11 (i.e. first position of 8 bp duplication). GCGCTGGTGA GTCCTGACGA AGATCGCAAG AAGAGGGTTC GTAACTTACA CGAACATGTT ACTAGACAGG CCCCGAGTCG CCTGCTGACG GGGCCCGAAA ACACGAGAGC CGAGCGC 4. Your assumption is correct, the l(1)G0396 strain is mutated in the KAP3 gene. 5. My fault again. The correct sequence for l(1)G0252 follows. It is derived from 5' inverse PCR and has the P insertion at position 119 (i.e. first position of 8 bp duplication). CCGGGTTTTG CCGCCCAACC TTTCGCTATT GCCTTTGCTT TCCTTTCCGC ACTTTTTGCA CTGTTCACCG ATCGCTTTTC GCTTCTCTTC TCGTTTTTCT CTCTTTTCCA CTAGCGCTGG CCAGCC 6. Yes, both lines gave the same insertion sequences. They were originally isolated from different remobilisation vials. I can, however, not exclude that \- likely \- an error occurred during the passages until we determined the insertion site. 7. Yes, our only line with a GawB insertion. 8. It's my fault again. The correct sequence for l(1)G0460a follows. It is derived from 3' plasmid rescue and has, therefore, the P insertion at position 1 (i.e. first position of 8 bp duplication). GAGGAGGCAA TGAAAAATGA CAATCATCAT TATATACACT TGAGCGGATC GACGACAGTC GCCGATCGTG TGCTCGTCGT CTTCTCAAGT TGAAACTGAA ATTGCTACGA CTTTGTCGTC TCTTCCTTCT TCTCCGCCGA CATCTCCTTG TCTTTTTCAG TCTCCGTCTC CATCTTTATA TTTTTCTCTT CACATGCGTG TTTGAGAATC ATCTGGGGGA GAGGGAGAAT AGAGATCGGT CCAAGCTCAA GTGAGTGGTT TGACTTTAAG AGATGCATAG ATACTTTGGC TTGCATAATA ATAATAATAA TAATAGTAAT GATCGCTGGT CGAAGGAAGA AGCCATGCAG AAAGATACGG GACGATATGA TGGCGAATGA TACTCTTTCA TGGTGGTCTT GGGAGTTTTA GAATCATTAC AGATACCCTC ACTCAAAACA TAAGCAAAGA TAAAAGAATT AATTGCAAAT TTGACAGATA TGGGTTATAT AACTATAAAT TGGAAAACTC ACGTACAGCT AAAGGTTAGA TCATTCTAAA GGTAACTGGA TACCCTGATA GATCCTTAAG ATAAATAAAA GGCACCTTCG AAACTGCAGG ATACACAAAC ACTGAGATAA ACACATGCTT CAAGCTGCCA CTTGAAAATG TATCTCAAAT TCAAGCGTCT GACACTCGCT GGCTCTATAA AGTCTTAAGA TGAGAATCTT GAAGGAAATA TGTAAGAAGG ATGTCTCTGT TTTGGCTTGC GATTCCCAAC GAACGATTTG AAGTTTAACT ATAAATATAA GATACCTAAG TTTCGATTTA GGTACATATG TACATATCTG GAATTAAAGT CCAGTTTTTT TATGGCTGCA TGATTGTAGC AACTGCGTTC ACTTCATCTG ACGCTCACTT AGCATTGATT AGTAGCCATA TCTCGCGGAT GCATCTTTCT CTTTGACTTT AGCCCTAAG ... I hope the information I provided is sufficient for you. ... regards Ulrich \-- Dr. Ulrich Schaefer Max-Planck-Institut fuer biophysikalische Chemie Abt. Molekulare Entwicklungsbiologie 37070 Goettingen GERMANY Street address: Am Fassberg 11, 37077 Goettingen Phone: (+49) 551 201-1798 Fax: (+49) 551 201-1755 __ (oo) Have a look at the web page of the department! /( )\ URL: http://www.mpibpc.gwdg.de/abteilungen/170/ ^^ |
||
| DOI | |||
| Related Publication(s) | |||
| Research paper | Mapping and identification of essential gene functions on the X chromosome of Drosophila. Peter et al., 2002, EMBO Rep. 3(1): 34--38 [FBrf0144855] |
||
Recent Updates
|
|||
| Description |
What does this section display?
This section contains items that were added to this record for each release.
It currently only tracks new links between this FlyBase report and other
FlyBase data classes (e.g. genes, references, stocks) or controlled
vocabulary terms (e.g. GO, anatomy terms).
What does this section not display?
This section does not currently display links that were removed or gene model changes.
|
||
| Update Feed |
Click the icon below to subscribe to this FlyBase record and receive updates automatically through your
feed reader.
|
||
| FB2013_03 | |||
| FB2013_02 | |||
| All updates | Click here to see a list of all updates to this record from FB2010_08 and on. | ||
Associated Information
|
|||
| Comments | |||
| Associated Files | |||
Other Information
|
|||
| Secondary IDs | |||
| Language of Publication | English | ||
| Additional Languages of Abstract | |||
| Also Published As | |||
Parent Publication
|
|||
| Publication Type | |||
| Abbreviation | |||
| Title | |||
| ISBN/ISSN | |||
Data from Reference
|
|||
Alleles (37)
|
|||
|
|||
Genes (34)
|
|||
Insertions (34)
|
|||
|
|||
Recent Updates