Open Close
Reference
Citation
Schäfer, U. (2003.12.4). Gottingen X chromosome P{lacW} insertion line questions. 
FlyBase ID
FBrf0173177
Publication Type
Personal communication to FlyBase
Abstract
PubMed ID
PubMed Central ID
Text of Personal Communication
To: uschaef@XXXX
Subject: FlyBase query: Gottingen P-element lines
From: Gillian Millburn (Genetics) <gm119@XXXX>
Date: Wed, 3 Dec 2003  17:59:45  \+0000
Dear Dr. Schaefer,
I am a curator working for FlyBase. I am curating the supplementary
information from your paper Peter et al., 2002, EMBO Rpts 3(1): 34--38
which contains the information about all the Gottingen X chromosome
P{lacW} insertion lines to get the information into the database and I
have a few questions to try and clarify what is going on in a few of
the lines.
I got the supplementary information as a table from:
ftp://ftp.ebi.ac.uk/pub/databases/edgp/200111/PX-lines.txt
the format for each P-element line in the above file is as follows:
and I have just copied the line relevant to each particular P-insertion
in the questions I have that follow. I am sorry there are several
questions, I have tried to organise them into similar categories to
make it easier. Any extra information you can give me about these
lines would be very useful and I would record the information as a
personal communication from you to FlyBase.
1. viable lines.
The following lines are listed as viable in the supplementary
information, but we already have a record of them in FlyBase as lethal
genes \+ alleles.
My question for these is, in each case, is there any lethality in the
strain or are the flies homozygous viable ? If the flies are homozygous
viable I will remove the lethal alleles from FlyBase and will just make
insertion records to store the information like the accession number
and the affected gene.
If there is some homozygous lethality in the strain, does this mean
that in each case the lethality is separable from the insertion ?
The lines are:
l(1)G0500,AJ300032,12282,2C2,2C1-2,east,viable
l(1)G0123,AJ426927,11885,13E3-8,13E1-6,sog,viable
l(1)G0104,AJ427038,11817,,12D,yoyo,viable
l(1)G0398,AJ427047,11909,,12C,yoyo,viable
l(1)G0250,AJ426807,11925,8D10-12,8E1-8,CG17251,viable
l(1)G0346,AJ426808,11929,8D10-12,8E1-4,CG17251,viable
l(1)G0400,AJ426812,12006,8F3-5,(3A1-4 &) 8F,CG15321,viable
l(1)G0230,AJ426821,11955,9B6-7,9B1-8,CG2968,viable
l(1)G0444,AJ426867,12049,10C4-5,10C1-2,CG1558,viable
l(1)G0185,AJ426901,12153,12D4-E1,12E5-7,CG11595,viable
l(1)G0225,AJ427021,12231,18F1-2,18F,CG12701,viable
l(1)G0094a,AJ426682,11811,4C8,4D1-2,ctp,viable
l(1)G0094b,AJ426841,11811,9E2-4,9E3-4,ras,viable
2. discrepancies between cytology and sequence localisation
a. In the following lines there is a discrepancy between the
'LOCALIZATION' (determined molecularly) and the 'IN SITU HYBRIDIZATION'
localisation.
In each case, could you tell me whether you think that this means that
there are actually 2 inserts \- one defined by the accession number and
one defined by the in situ hybridisation, or whether you think there is
just one insertion and there is an error in the in situ value.
The lines are:
l(1)G0031,AJ299996,,1B5-6,12C,elav,E
l(1)G0024,AJ300007,11496,1D1,3B,BACR7A4.15,L3
l(1)G0015,AJ300074,,3C7,2C7-8,N,E
l(1)G0449,AJ426694,10104,5C5-6,4D4-6,Act5C,'L3, short L3s'
l(1)G0182,AJ426748,11950,7A4,12A1-2,brk,E
l(1)G0327,AJ426757,12292,7C8-D1,1B7-10,CG2206,L1-L2
l(1)G0238,AJ426839,11957,9E2-4,7E3-6,ras,fl
l(1)G0141,AJ426868,10148,10C6-7,11A7-8,CG1703,'L3-pP-P-pA-A, short bristles, ms'
l(1)G0476,AJ426910,10127,12D4-E1,13E1-4,CG1405,L3-pP
l(1)G0285,AJ426999,11965,18D8-11,19E,CG12238,fs
l(1)G0196,AJ427035,11872,19F6-20A1,9E1-4,CG14616,L1-L2
l(1)G0270,AJ426818,11873,8F3-5,9E4-10,CG15321,P-pA
l(1)G0473,AJ426952,10125,14B9-12,11B1-4,CG3415/katanin-80,fs
b. the following 2 lines also show a discrepancy between the cytology
and sequence localisation, and in addition they are also listed as
viable:
l(1)G0495,AJ426760,12280,7D5-6,12C,fs(1)h,viable
l(1)G0060,AJ426693,11653,5B2-5,11B1,CG3125,viable
for these, could you tell me whether you think that this means that
there are actually 2 inserts \- one defined by the accession number and
one defined by the in situ hybridisation, or whether you think there is
just one insertion and there is an error in the in situ value. In
addition, are these lines homozygous viable or is there a separable
lethality somewhere in the strain (like question 1.)
3. l(1)G0459,AJ427049,12260,,3A & 10E-F,yoyo,fs
By BLAST, the AJ427049 sequence given for this line is in the gene
c12.1 and is identical to the sequence given in accession record
AJ426806 \- is the sequence in AJ427049 a mistake ?
here is the sequence I got from EMBL for AJ427049:
>embl|AJ427049|DME427049 Drosophila melanogaster X chromosomal sequences
flanking P-lacW insertion, strain l(1)G0459
gtactgttgatacatcaaacaaagcacgcagttcggaaattcatttctcttttcattaat
ttaacaattaaacgcataactagctagttgaaaatgaccacagcagcgc
Also, in a previous personal communication to FlyBase (FBrf0125103,
 date:1999.12.2 ) you gave the in situ localisation for l(1)G0459 as 7D
Could you tell me which in situ localisation is correct \- 3A & 10E-F as
given in the supplementary info, or 7D as in FBrf0125103.
4. l(1)G0396,AJ426858,,10B8,10B1-2,KAP3,'pA, die at hatching'
I just wanted to check that the 'KAP3' mentioned in your abstracts:
Peter et al., 1999, Europ. Dros. Res. Conf. 16: 264
'Characterization of a gene encoding the kinesin associated protein 3
(KAP3) in Drosophila melanogaster.'
and
Pflanz et al., 2001, Europ. Dros. Res. Conf. 17: O4
'Functional analysis of the kinesin-associated protein KAP3.'
is the same gene as the one affected in the l(1)G0396 strain.
5.
l(1)G0252,AJ426889,11880,11D5-6,11C,lic,'semilethal, m & f'
The sequence of AJ426889 at EMBL is identical to AJ426848 and does not
map to lic in 11C but maps by BLAST to region 9 cytologically in
sesB/Ant2 \- has there been a mistake in the sequence in AJ426889 ?
here is the sequence I got from EMBL of AJ426889:
>embl|AJ426889|DME426889 Drosophila melanogaster X chromosomal sequences
flanking P-lacW insertion, strain l(1)G0252
atagcccatttaacaaaanacgngngtggttccaaangcttttattaatanttttttttt
ttaaatcaaatccaacctgagcattgaaagaaaatctgcctggttatgtaaaacaacaaa
agagttgaacttgaatcattcattgaacaattttttttntggtgtgtggtggtggtctta
tgcaatcaatacncaatgaattaagaataatcttaacactggattgtggatacanctaag
gctgttcagccttcggtggaagctttccacgtgcaactgtagaatttttccagctgaggc
tattacatcacgagccntttagctatnggctctntgnggctgtggccgaagaaaaagctt
cactctctttccagccaatcaaaagtctaacacgattagataacggttgttatttcaaag
aaagagaacanaagagnagcgaancaatggcaaagcccagttctctttgccaagtgtgtt
acataaaacccttgtcaatgaaatgctgatttaatttcgctaaaatattttttaaaccac
gcggctaacgcagagcggcggcatgctcttgaaagtctaaaattaacaatacgcgc
6. the sequence in the two accession number AJ427025 (l(1)G0004 ) and
AJ427026 (l(1)G0005) are identical \- is this correct ?
here are the sequences I got from EMBL:
>embl|AJ427025|DME427025 Drosophila melanogaster X chromosomal sequences
flanking P-lacW insertion, strain l(1)G0004
gatcccagcacctggccctcaatgccggtcgcctcatccacctgcatctccacgtcctgc
tgcccgcctccgctggctccgcgcttcgtcgctctcttcgccggctcgaatgcgtctgct
c
>embl|AJ427026|DME427026 Drosophila melanogaster X chromosomal sequences
flanking P-lacW insertion, strain l(1)G0005
gatcccagcacctggccctcaatgccggtcgcctcatccacctgcatctccacgtcctgc
tgcccgcctccgctggctccgcgcttcgtcgctctcttcgccggctcgaatgcgtctgct
c
7. l(1)G0001,,,,nd (P-GawB!),yoyo,E
I just wanted to check that this strain contains a GawB insertion
instead of a lacW ?!
8.
l(1)G0460a,AJ300082,,3C7,nd,N,E
l(1)G0460b,AJ426801,,8B4-7,8B3-7,Moe,E
the sequences given in AJ300082 and AJ426801 are identical and both map
to Moe in 8B. Is there are mistake with AJ300082 as it is said to map
to 3C in N ?
here are the sequences I got from EMBL:
>embl|AJ300082|DME300082 Drosophila melanogaster X chromosomal sequence
flanking P-lacW insertion strain l(1)G0460a
gcgtcggcttttcatttttcgttcatttatttattttcctctccagtttttttttttttt
tttgggtgcaacaagtgtgcggcgctttgttgtttttgtaccgttttttatgttaattaa
ccaaaacgagttgttgttcgtgtgtttgctatgcttgactagttaagcgcgtagagagca
aaagagatggagagggagcgaacgaaagagagaggaagaaagatcattacgtaatgggga
aaacgttgctttcaaattctccagtgttgccaccttatcaaaatgacacttgttacgctc
cgcgacccctttttaacccttttccattgcttatttaaaaatttaaattaaacatttttt
atgaaaatttcaaaagttttcctattcacctgtttttttagtggtcaaaacattttatgc
caacgtgaattggcaatactggttgttaagccgcgtgactcgtttttttttttgaccgca
cataaaattcaaatttttgttgtttgtttaccgatcatcttgcattctctcgctcgcttt
tatttctctctgtttgcatttcgttttgactccttctttggccttactcatttgatttcg
gacgcttgagacgtgcgcttttcgcagcaatcgcatcgaaagaagagagcaaggagttgc
gagggagagatgaagtgaccgaaagagagagtcaaaagagagtagacttttcttctagaa
accacgatgccttttaataaatcatagttttccaagtgagtaattttaaccccgccttca
cccaattattcaaatgcagcggngccgagaaaaaattatattgtnaatgccatgggtcaa
aaaaaaaagctgc
>embl|AJ426801|DME426801 Drosophila melanogaster X chromosomal sequences
flanking P-lacW insertion, strain l(1)G0460b
gcgtcggcttttcatttttcgttcatttatttattttcctctccagtttttttttttttt
tttgggtgcaacaagtgtgcggcgctttgttgtttttgtaccgttttttatgttaattaa
ccaaaacgagttgttgttcgtgtgtttgctatgcttgactagttaagcgcgtagagagca
aaagagatggagagggagcgaacgaaagagagaggaagaaagatcattacgtaatgggga
aaacgttgctttcaaattctccagtgttgccaccttatcaaaatgacacttgttacgctc
cgcgacccctttttaacccttttccattgcttatttaaaaatttaaattaaacatttttt
atgaaaatttcaaaagttttcctattcacctgtttttttagtggtcaaaacattttatgc
caacgtgaattggcaatactggttgttaagccgcgtgactcgtttttttttttgaccgca
cataaaattcaaatttttgttgtttgtttaccgatcatcttgcattctctcgctcgcttt
tatttctctctgtttgcatttcgttttgactccttctttggccttactcatttgatttcg
gacgcttgagacgtgcgcttttcgcagcaatcgcatcgaaagaagagagcaaggagttgc
gagggagagatgaagtgaccgaaagagagagtcaaaagagagtagacttttcttctagaa
accacgatgccttttaataaatcatagttttccaagtgagtaattttaaccccgccttca
cccaattattcaaatgcagcggngccgagaaaaaattatattgtnaatgccatgggtcaa
aaaaaaaagctgc
that's it, sorry there are so many questions \!
Gillian
\--------------------------------------------------------------
Gillian Millburn.
FlyBase (Cambridge),
Department of Genetics,
University of Cambridge,
Downing Street, email: gm119@XXXX
Cambridge, CB2 3EH, Ph : 01223-333963
UK. FAX: 01223-333992
FlyBase: http://fbserver.gen.cam.ac.uk/
\--------------------------------------------------------------
Date: Thu, 4 Dec 2003  11:33:07  \+0100
To: Gillian Millburn (Genetics) <gm119@XXXX>
From: Ulrich Schaefer <uschaef@XXXX>
Subject: Re: FlyBase query: Gottingen P-element lines
Dear Gillian,
thank you for your e-mail and particularly for the effort in sieving
through our data on those lethal lines. ... I will go through all your
questions in the order you mailed me and I will answer them and
correct any errors.
1.
The P insertion lines were kept if the insertion caused lethality
(few escapers <1% compared to their FM7c brothers that were already
clearly affected in their viability) or semilethality (<20% of FM7c
brothers). I did a quantitative recheck of the lethal effect after
the final establishing of the lines. In addition, Peter Deak in David
Glover's lab screened our lines for the timepoint of lethality and his
data are incorporated in the table. The label 'viable' just points
out that adult flies eclosed in his analysis even when I could find
none or only a few escapers as listed below.
l(1)G0500: semilethal (<20% of FM7c control)
l(1)G0123: semilethal (<10% of FM7c control)
l(1)G0104: semilethal (<10% of FM7c control)
l(1)G0398: semilethal (<5% of FM7c control)
l(1)G0250: semilethal (<10% of FM7c control)
l(1)G0346: semilethal (<5% of FM7c control)
l(1)G0400: lethal (<1% of FM7c control), no escapers in my hands
l(1)G0230: lethal (<1% of FM7c control), no escapers in my hands
l(1)G0444: semilethal (<20% of FM7c control)
l(1)G0185: lethal (<1% of FM7c control), no escapers in my hands
l(1)G0225: lethal (<1% of FM7c control)
l(1)G0094a,l(1)G0094b: semiviable (<50% of FM7c control), faint
bristles and female sterile
In addition, I should point out that Timothy Karr (University of
Bath) has detected Wolbachia in most of our strains and that the
strength of this bacterial infection might influence the vitality of
the flies.
2.
a) Although there is no final proof available we have no evidence for
another site as indicated by the in situ hybridisation. Hence,
everything is in favor that the molecular localisation is correct and
that the in situs are misinterpreted.
b) Same answer as in 2a). With regard to the viability here are my
data (also seen in the background of 1)
l(1)G0495: lethal (<1% of FM7c control)
l(1)G0060: lethal (<1% of FM7c control), no escapers in my hands
3.
My fault. I did submit the same sequence twice as you suggested. The
correct sequence for l(1)G0459 follows. It is derived from 5' and 3'
inverse PCR and has the P insertion at position 11 (i.e. first
position of 8 bp duplication).
GCGCTGGTGA GTCCTGACGA AGATCGCAAG AAGAGGGTTC GTAACTTACA CGAACATGTT
ACTAGACAGG CCCCGAGTCG CCTGCTGACG GGGCCCGAAA ACACGAGAGC CGAGCGC
4.
Your assumption is correct, the l(1)G0396 strain is mutated in the KAP3 gene.
5.
My fault again. The correct sequence for l(1)G0252 follows. It is
derived from 5' inverse PCR and has the P insertion at position 119
(i.e. first position of 8 bp duplication).
CCGGGTTTTG CCGCCCAACC TTTCGCTATT GCCTTTGCTT TCCTTTCCGC ACTTTTTGCA
CTGTTCACCG ATCGCTTTTC GCTTCTCTTC TCGTTTTTCT CTCTTTTCCA CTAGCGCTGG
CCAGCC
6.
Yes, both lines gave the same insertion sequences. They were
originally isolated from different remobilisation vials. I can,
however, not exclude that \- likely \- an error occurred during the
passages until we determined the insertion site.
7.
Yes, our only line with a GawB insertion.
8.
It's my fault again. The correct sequence for l(1)G0460a follows. It
is derived from 3' plasmid rescue and has, therefore, the P insertion
at position 1 (i.e. first position of 8 bp duplication).
GAGGAGGCAA TGAAAAATGA CAATCATCAT TATATACACT TGAGCGGATC GACGACAGTC
GCCGATCGTG TGCTCGTCGT CTTCTCAAGT TGAAACTGAA ATTGCTACGA CTTTGTCGTC
TCTTCCTTCT TCTCCGCCGA CATCTCCTTG TCTTTTTCAG TCTCCGTCTC CATCTTTATA
TTTTTCTCTT CACATGCGTG TTTGAGAATC ATCTGGGGGA GAGGGAGAAT AGAGATCGGT
CCAAGCTCAA GTGAGTGGTT TGACTTTAAG AGATGCATAG ATACTTTGGC TTGCATAATA
ATAATAATAA TAATAGTAAT GATCGCTGGT CGAAGGAAGA AGCCATGCAG AAAGATACGG
GACGATATGA TGGCGAATGA TACTCTTTCA TGGTGGTCTT GGGAGTTTTA GAATCATTAC
AGATACCCTC ACTCAAAACA TAAGCAAAGA TAAAAGAATT AATTGCAAAT TTGACAGATA
TGGGTTATAT AACTATAAAT TGGAAAACTC ACGTACAGCT AAAGGTTAGA TCATTCTAAA
GGTAACTGGA TACCCTGATA
GATCCTTAAG ATAAATAAAA GGCACCTTCG AAACTGCAGG ATACACAAAC ACTGAGATAA
ACACATGCTT CAAGCTGCCA CTTGAAAATG TATCTCAAAT TCAAGCGTCT GACACTCGCT
GGCTCTATAA AGTCTTAAGA TGAGAATCTT GAAGGAAATA TGTAAGAAGG ATGTCTCTGT
TTTGGCTTGC GATTCCCAAC GAACGATTTG AAGTTTAACT ATAAATATAA GATACCTAAG
TTTCGATTTA GGTACATATG TACATATCTG GAATTAAAGT CCAGTTTTTT TATGGCTGCA
TGATTGTAGC AACTGCGTTC ACTTCATCTG ACGCTCACTT AGCATTGATT AGTAGCCATA
TCTCGCGGAT GCATCTTTCT CTTTGACTTT AGCCCTAAG
...
I hope the information I provided is sufficient for you. ...
regards
Ulrich
\--
Dr. Ulrich Schaefer
Max-Planck-Institut fuer biophysikalische Chemie
Abt. Molekulare Entwicklungsbiologie
37070 Goettingen
GERMANY
Street address: Am Fassberg 11, 37077 Goettingen
Phone: (+49) 551 201-1798
Fax: (+49) 551 201-1755
__
(oo) Have a look at the web page of the department!
/( )\ URL: http://www.mpibpc.gwdg.de/abteilungen/170/
^^
DOI
Related Publication(s)
Research paper

Mapping and identification of essential gene functions on the X chromosome of Drosophila.
Peter et al., 2002, EMBO Rep. 3(1): 34--38 [FBrf0144855]

Associated Information
Comments
Associated Files
Other Information
Secondary IDs
    Language of Publication
    English
    Additional Languages of Abstract
    Parent Publication
    Publication Type
    Abbreviation
    Title
    ISBN/ISSN
    Data From Reference
    Alleles (37)
    Genes (34)
    Insertions (34)