Open Close
Reference
Citation
Ashburner, M. (2004.6.30). Liang anon-ESTs. 
FlyBase ID
FBrf0178761
Publication Type
Personal communication to FlyBase
Abstract
PubMed ID
PubMed Central ID
Text of Personal Communication
Date: Wed, 30 Jun 2004  16:44:55  \+0100 (BST)
From: 'Michael Ashburner (Genetics)' <ma11@XXXX>
Subject: Re: Liang anon-EST's
To: michaelXXXX, crosbyXXXX
Cc: rd120XXXX, gm119XXXX
...
See attached file for Lang EST cleanup.
File as a pc and do the merges needed. For those that are
not in genome or are plasmid vector I suggest add a note and
these must be status_uncertain
Q's to me
Michael
Executive summary;
anon- EST:Liang-1.11  == CG9022?
anon- EST:Liang-1.13  = CG11798
anon- EST:Liang-1.16  = CG31738
anon- EST:Liang-1.18  == CG11107
anon- EST:Liang-1.21  == CG5931
anon- EST:Liang-1.24  = CG32743
anon- EST:Liang-1.25  = CG11525
anon- EST:Liang-1.3  = ? something new ?
anon- EST:Liang-1.34  = ? something new ?
anon- EST:Liang-1.38  == something new ?
anon- EST:Liang-1.39  = no sequence data available
anon- EST:Liang-1.4  = CG7977
anon- EST:Liang-1.40  == ? not in genome
anon- EST:Liang-1.43  = CG5720
anon- EST:Liang-1.52  = CG3998
anon- EST:Liang-1.53  = looks like bacterial plasmid seq to me
anon- EST:Liang-1.56  = CG7808
anon- EST:Liang-1.62  no sequence data available
anon- EST:Liang-1.66  = CG4978
anon- EST:Liang-1.72  = CG12011
anon- EST:Liang-1.74  = CG14938
anon- EST:Liang-1.75  = CG5481
anon- EST:Liang-1.76  = CG31363
anon- EST:Liang-1.79  = CG5395
anon- EST:Liang-1.80  == CG14996
anon- EST:Liang-1.83  = CG7055
anon- EST:Liang-2.1  no sequence data available
anon- EST:Liang-2.12  = CG17841
anon- EST:Liang-2.13  = ? on hth intron ?
anon- EST:Liang-2.14  = sd?
anon- EST:Liang-2.15  == CG15100
anon- EST:Liang-2.16  = CG4602? match bad, but note n's in query seq
>anon- EST:Liang-2.19  = CG32177
anon- EST:Liang-2.2  = CG15154
anon- EST:Liang-2.23  = roo element
anon- EST:Liang-2.24  == CG11525
anon- EST:Liang-2.28  = CG2210
anon- EST:Liang-2.31  = not in genome
anon- EST:Liang-2.39  = in how intron ?
anon- EST:Liang-2.40  = no sequence data available
anon- EST:Liang-2.41  = CG32662
anon- EST:Liang-2.42  = CG5014
anon- EST:Liang-2.47  = CG1499
anon- EST:Liang-2.48  = CG14938
anon- EST:Liang-2.49  = CG3821
anon- EST:Liang-2.51  == CG7533 (charybde) (1-635 only; chimeric? Last
anon- EST:Liang-2.54  == CG9894
anon- EST:Liang-20  == CG10035
anon- EST:Liang-38  == CG17579 (sca)
anon- EST:Liang-97  == CG3359 (1-468 only; chimeric cDNA? Last 300bp not
identifiable \-- het?)
Michael
\#
1. Blast at FB vs Predicted genes NT
2. If no: Blast at FB vs euchromatic and heterochromatic scaffolds NT
2. Blast Drosophila TE's at FB
4. If no Blast at FB all Drosophila NT
5. Blastn at NCBI
\#
anon- EST:Liang-1.11  == CG9022?
>anon- EST:Liang-1.11 
aaaantggnc ataatggtng tgnantangc atagagcggt gtgttnnata agntggnngg
taatcngaac ntngtngagt ntattatnaa ntgggtattt ggngagantg gtntnttgnn
nnnggcatnn gtgtaagatt ataaggaggg gganntgntg ttacgggata aggnn
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003446 |gb|AE003446| arm:X  8788012..9078081
estimated- cyto:8C4-8E1  gadfly- seqname:AE003446 
 seq_release:3 
Length = 290070
Score = 81.4 bits (42), Expect = 6e-15 Genome Map
Identities = 107/154 (69%)
Strand = Plus / Minus
Query: 20 gtgnantangcatagagcggtgtgttnnataagntggnnggtaatcngaacntngtngag 79
||| | || ||| ||||||||||||| | ||| ||| ||||||| || | | |||
Sbjct: 108565 gtgcagtacgcacagagcggtgtgttccacaagctggccggtaatcgcgacgtggccgag
108506
Query: 80 tntattatnaantgggtatttggngagantggtntnttgnnnnnggcatnngtgtaagat 139
| |||| || ||||||||||| |||| ||| ||| ||||| ||| || ||
Sbjct: 108505 tccattagcaagtgggtatttggagagactggccgcttgcgcgtggcatccgtgcaacat
108446
Query: 140 tataaggaggggganntgntgttacgggataagg 173
| |||||||| || || || || |||| |||
Sbjct: 108445 cacaaggagggcgagctgctgccaccggatcagg 108412
BLAST against: Database: dmel_all_transcript_r320
>CG9022-RA type=mRNA;
loc= X:complement (8895906..8897199,8897274..8897495); Genome Map
ID=Ost48-RA; name=Ost48-RA;
db_xref='CG9022,FlyBase:FBgn0014868'; len=1516
Length = 1516
Score = 81.4 bits (42), Expect = 2e-15
Identities = 107/154 (69%)
Strand = Plus / Plus
Query: 20 gtgnantangcatagagcggtgtgttnnataagntggnnggtaatcngaacntngtngag 79
||| | || ||| ||||||||||||| | ||| ||| ||||||| || | | |||
Sbjct: 846 gtgcagtacgcacagagcggtgtgttccacaagctggccggtaatcgcgacgtggccgag 905
Query: 80 tntattatnaantgggtatttggngagantggtntnttgnnnnnggcatnngtgtaagat 139
| |||| || ||||||||||| |||| ||| ||| ||||| ||| || ||
Sbjct: 906 tccattagcaagtgggtatttggagagactggccgcttgcgcgtggcatccgtgcaacat 965
Query: 140 tataaggaggggganntgntgttacgggataagg 173
| |||||||| || || || || |||| |||
Sbjct: 966 cacaaggagggcgagctgctgccaccggatcagg 999
Database: na_all.dros
>BACR19P22-T7 (STS) made from BACR19P22
Length = 809
Score = 81.4 bits (42), Expect = 3e-14
Identities = 107/154 (69%)
Strand = Plus / Plus
Query: 20 gtgnantangcatagagcggtgtgttnnataagntggnnggtaatcngaacntngtngag 79
||| | || ||| ||||||||||||| | ||| ||| ||||||| || | | |||
Sbjct: 476 gtgcagtacgcacagagcggtgtgttccacaagctggccggtaatcgcgacgtggccgag 535
Query: 80 tntattatnaantgggtatttggngagantggtntnttgnnnnnggcatnngtgtaagat 139
| |||| || ||||||||||| |||| ||| ||| ||||| ||| || ||
Sbjct: 536 ttcattagcaagtgggtatttggagagactggccgcttgcgcgtggcatccgtgcaacat 595
Query: 140 tataaggaggggganntgntgttacgggataagg 173
| |||||||| || || || || |||| |||
Sbjct: 596 cacaaggagggcgagctgctgccaccggatcagg 629
\#
anon- EST:Liang-1.13  = CG11798
>anon- EST:Liang-1.13 
aaaagcttgc ttgttctttt tgcagaagct cagaataaac gctcaacttt gggacctgca
cccccccccc cccccctcga tcgctcggca gcgcccagca ttgaatacga gtccagtgcg
gccggtgcct ctggcaacaa cttggccacc acccaggcca atgtaatcca caacaacagc
agcagcaaca gcaagcggag tcgggcaact ccgtggtggt gacggccaca gtggggcgac
tgtggtgccg gcacccagtg tatcggccgt tggtggcttc aagtccgagg atcatctgag
cactgccttc gggctggcag ccctgatgca aacggtttcg caccggccag gcgggtctgc
tgaaaccggc gagcaacaaa gcgctgggct caggacggat ctggtctggt ggcgccgcac
cggcggaacc acaactcgtg cagtggactc gggcggaaag ctccaagcta cgctcatgtc
aaccaacacg cacactaata acccgcatag acatccaatc aaaaaacacc taggaacatg
cggctgaatt gattaccacc ccccacatcg ggcaatgcgg gccaaaatct tggcccaaat
ccatatccac cttagcgccc atgtaatatg cgttgggggc tcacactcct ccggtggaaa
gaagggtccg aaaaggccct accgttttcc gcc
Database: dmel_all_transcript_r320
>CG11798-RA type=mRNA;
loc= 2R:join (10192641..10192910,10201827..10202161,
10202234..10202706,10202804..10203820,
10205562..10208508); ID=CG11798-RA; name=CG11798-RA;
db_xref='CG11798,FlyBase:FBgn0033992'; len=5042
Length = 5042
Genome Map
Score = 642 bits (334), Expect = 0.0
Identities = 407/421 (96%), Gaps = 9/421 (2%)
Strand = Plus / Plus
Query: 77 tcgatcgctcggcagcgcccagcattgaatacgagtccagtgcggccggtgcctctggca 136
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 613 tcgatcgctcggcagcgcccagcattgaatacgagtccagtgcggccggtgcctctggca 672
Query: 137 acaacttggccaccacccaggccaatgtaatcca-caacaacagcagcagcaacagcaag 195
||||| |||||||||||||||||||||||||||| |||||||| ||||||||||||||||
Sbjct: 673 acaacgtggccaccacccaggccaatgtaatccagcaacaacaacagcagcaacagcaag 732
Query: 196 cggagtcgggcaactccgtggtggtgacggcca-cagtggggcgactgtggtgccggcac 254
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 733 cggagtcgggcaactccgtggtggtgacggccagcagtggggcgactgtggtgccggcac 792
Query: 255 ccagtgtatcggccgttggtggcttcaagtccgaggatcatctgagcactgccttcgggc 314
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 793 ccagtgtagcggccgttggtggcttcaagtccgaggatcatctgagcactgccttcgggc 852
Query: 315 tggcagccctgatgca-aacggtttcgca-ccggccaggcgggtctgctgaaa-ccggcg 371
|||||||||||||||| |||||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 853 tggcagccctgatgcagaacggtttcgcagccggccaggcgggtctgctgaaagccggcg 912
Query: 372 agcaacaa-agcgctgggctcaggacggatctggtctggtggc-gccgcaccggcggaac 429
|||| ||| |||||||||||||||||||||||||||||||||| |||||| |||||||||
Sbjct: 913 agcagcaacagcgctgggctcaggacggatctggtctggtggcggccgcagcggcggaac 972
Query: 430 cacaactcgtgcagtgga-ctcgggcggaaagctcca-agctacgctcatgtcaaccaac 487
|||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||
Sbjct: 973 cacaactcgtgcagtggacctcgggcggaaagctccagagctacgctcatgtcaaccaac 1032
Query: 488 a 488
|
Sbjct: 1033 a 1033
\#
anon- EST:Liang-1.16  = CG31738
>anon- EST:Liang-1.16 
agcagttcca gttccctaaa actgggctgg gagcggcggg ctcaagatgg tgacttcctg
ctgcaactac aagatgcaga aacaggtcat ggtttcctca atacctacaa gggtacagag
ctgcaaacgg agtgcctgca attaaggcgg gctagcagct accaattccg tctgagatcc
gaaaacgaag ccggtttttc accctggtca ccggaggtta gctaccgcac tttagcggaa
cgcccgggaa ggccagggaa accgcatgcc aagggaaaga ttcatggcac tcagtttaag
gcccgctggg atgcacccag cgattccggt ggtgctgaga tcctgtgcta ccacttggag
ttaagtgccg ctgggccaac tttcgaaagg atctacagtg gcgccgaaac agaagccatg
tgcgaaagac ttcagccggg taccacatac gctctgcgag cctgttgcga angtccaagc
tggtcagagt ccgtactccg atataggaca agtcaccacn gaaggcggtg ccaccaatct
gctcccgcct ccaaccgcaa ttgcagtgat cctccctcgc cgtacgccgc ccctactgaa
gctccggggc tcccggaata taaacngtng nngctccnga ttttaaaagt ttgnagcccc
aaaatccgtt cncctaanag cnaagttgcn agccngcccg cantttgggt ttaccgccgg
naaagcanaa cctanctttg ttggcccaag gatnttgaaa accc
Database: dmel_all_transcript_r320
>CG31738-RA type=mRNA;
loc= 2L:join (16635199..16635513,16635583..16636036,
16636108..16640110); ID=CG31738-RA; name=CG31738-RA;
db_xref='CG31738,FlyBase:FBgn0051738'; len=4772
Length = 4772
Genome Map
Score = 1040 bits (541), Expect = 0.0
Identities = 596/607 (98%), Gaps = 7/607 (1%)
Strand = Plus / Plus
Query: 1 agcagttccagttccctaaaactgggctgggagcggcgggctcaagatggtgacttcctg 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1747 agcagttccagttccctaaaactgggctgggagcggcgggctcaagatggtgacttcctg 1806
Query: 61 ctgcaactacaagatgcagaaacaggtcatggtttcctcaatacctacaagggtacagag 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1807 ctgcaactacaagatgcagaaacaggtcatggtttcctcaatacctacaagggtacagag 1866
Query: 121 ctgcaaacggagtgcctgcaattaaggcgggctagcagctaccaattccgtctgagatcc 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1867 ctgcaaacggagtgcctgcaattaaggcgggctagcagctaccaattccgtctgagatcc 1926
Query: 181 gaaaacgaagccggtttttcaccctggtcaccggaggttagctaccgcactttagcggaa 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1927 gaaaacgaagccggtttttcaccctggtcaccggaggttagctaccgcactttagcggaa 1986
Query: 241 cgcccgggaaggccagggaaaccgcatgccaagggaaagattcatggcactcagtttaag 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1987 cgcccgggaaggccagggaaaccgcatgccaagggaaagattcatggcactcagtttaag 2046
Query: 301 gcccgctgggatgcacccagcgattccggtggtgctgagatcctgtgctaccacttggag 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2047 gcccgctgggatgcacccagcgattccggtggtgctgagatcctgtgctaccacttggag 2106
Query: 361 ttaagtgccgctgggccaactttcgaaaggatctacagtggcgccgaaacagaagccatg 420
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 2107 ttaagtgccgctgggccagctttcgaaaggatctacagtggcgccgaaacagaagccatg 2166
Query: 421 tgcgaaagacttcagccgggtaccacatacgctctgcgagcctgttgcgaangtccaagc 480
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||
Sbjct: 2167 tgcgaaagacttcagccgggtaccacatacgctctgcgagcctgttgcgaaggtcc-agc 2225
Query: 481 tggtcagagtccgtactccgatataggacaagtcaccacngaaggcggtgccaccaatct 540
|||||||||||||||||||||||||||||| |||||||| | ||||||||||||| ||||
Sbjct: 2226 tggtcagagtccgtactccgatataggacacgtcaccacgg-aggcggtgccacc-atct 2283
Query: 541 gctcccgcctccaaccgcaattgcagtgatcctccctcgccgtacgccgcccctactgaa 600
||| |||||||| ||||| |||||||||||||||||||||||||||||| ||||||||||
Sbjct: 2284 gct-ccgcctcc-accgc-attgcagtgatcctccctcgccgtacgccg-ccctactgaa 2339
Query: 601 gctccgg 607
|||||||
Sbjct: 2340 gctccgg 2346
\#
anon- EST:Liang-1.18  == CG11107
\#
anon- EST:Liang-1.21  == CG5931
\#
anon- EST:Liang-1.24  = CG32743
>anon- EST:Liang-1.24 
aaagtacaga caaactgacg gacacggatt tgctgtggac cggaagccgt tggatcgtgg
catatgccac gtgctctctc ggatcgcaat ccgcattttg aattccgagt ggacataacg
agttgctggc cgagtagcag cagatgcagc ggctgacaca gcctcctata gctcccgatg
taagagatct gggctcgatg acgttatcgg atacgatata ttccaggttt tagatacaaa
attttcgttt accggccctc cgttatattt cctttttttt ttttaaaatg ctgttgtgca
acttttccta tacgattcga ttataaacta tatattaatt tacaccatac cggaagtgtt
ttttttttat tacgtgttaa gccactctca gtttcagccg ccttccccca ctcccctcta
aaaccaaatc tgtagccgca ttagaactat atgtacaacc caatatatat atatatatat
atatatatat gtatatgtat atccgcgatg cccgttcata gccgatgtcg gctatgcccg
cccgttctcg ttttagttat ttcaataaac acaatgctga atataaatat aaatgttcgt
ttccttcgag tgtaagtgag ctaanaactt tttgtgggaa taaaatcact cattttaatt
ttctaaaagt tcaanccccg aattgcgcat cccgtttttt actt
CG32743-RA type=mRNA;
loc= X:join (6565014..6565362,6565432..6565795,
6565866..6568125,6568194..6571694,6574241..6574560,
6574626..6575970,6576021..6576989,6577057..6577405,
6577477..6578626); ID=Smg1-RA; name=Smg1-RA;
db_xref='CG32743,FlyBase:FBgn0052743'; len=10607
Length = 10607
Genome Map
Score = 756 bits (393), Expect = 0.0
Identities = 434/463 (93%), Gaps = 1/463 (0%)
Strand = Plus / Plus
Query: 1 aaagtacagacaaactgacggacacggatttgctgtggaccggaagccgttggatcgtgg 60
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 9918 aaagtacagacagactgacggacacggatttgctgtggaccggaagccgttggatcgtgg 9977
Query: 61 catatgccacgtgctctctcggatcgcaatccgcattttgaattccgagtggacataacg 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 9978 catatgccacgtgctctctcggatcgcaatccgcattttgaattccgagtggacataacg 10037
Query: 121 agttgctggccgagtagcagcagatgcagcggctgacacagcctcctatagctcccgatg 180
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 10038 agttgctggccgagtagcagcagatgcagcggcttacacagcctcctatagctcccgatg 10097
Query: 181 taagagatctgggctcgatgacgttatcggatacgatatattccaggttttagatacaaa 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10098 taagagatctgggctcgatgacgttatcggatacgatatattccaggttttagatacaaa 10157
Query: 241 attttcgtttaccggccctccgttatattt-ccnnnnnnnnnnnnaaaatgctgttgtgc 299
|||||||||||||||||||||||| ||||| || ||||||||||||||
Sbjct: 10158 attttcgtttaccggccctccgttttatttccctttttttttttttaaatgctgttgtgc 10217
Query: 300 aacttttcctatacgattcgattataaactatatattaatttacaccataccggaagtgn 359
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 10218 aacttttcctatacgattcgattataaactatatattaatttacaccatactggaagtgt 10277
Query: 360 nnnnnnnnnattacgtgttaagccactctcagtttcagccgccttcccccactcccctct 419
|||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 10278 tttttttttattacgtgttaagccactcttagtttcagccgccttcccccactcccctct 10337
Query: 420 aaaaccaaatctgtagccgcattagaactatatgtacaaccca 462
|||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10338 aaaaccaaatctgtagccgcattagaactatatgtacaaccca 10380
\#
anon- EST:Liang-1.25  = CG11525
>anon- EST:Liang-1.25 
gagggccggt atgggacacc gggtgctgct ggcttggaat atcagaagta cgaacaacaa
caacaactgg aggatctggc ggagtccgag gcaggagccg tcggtggagc cagcaacaac
aacggcgaat cgtcgtcgtc cttgaaaaag ctagaggatc agctgcacgc cctcacctcg
gacgagttgt acgaaaccct caaggagtac gacgtcctgc aggacaagtt ccacacggtg
ctgctgttgc ccaaggaatc aaggcgtgag gttactgccg gaggacgaga tggatccgcc
tacgtgctgc gctgcctgaa gatgtggtac gagctgccct ccgacgtcct gttctcggcc
atgagcctgg tggaccgctt cctggatcgc atggccgtca agccgaagca catggcctgc
atgagcgtgg cctcgttcca cttggccatc aagcagctgg acttgaaacc cattcccgcc
gaggatctgg ttacaatatc tcantgtggt tgtaccgctg gtgatctgga acgcaaggcc
ggcgtngatt gccaacaaan ctgggcgttc aagatgggac atgcaccgat taacntctgt
gagctacctg gcgcatctac taangcccct cttccgcaaa ctttggncga aaggannatt
tggggggnga acttttttaa agnttctaac aaacaa
Database: dmel_all_transcript_r320
>CG11525-RD type=mRNA;
loc= 3R:complement (27413538..27414436,27415477..27415691,
27415762..27416136,27416200..27416439,27416504..27417318,
27427399..27427752); ID=CycG-RD; name=CycG-RD;
db_xref='CG11525,FlyBase:FBgn0039858'; len=2898
Length = 2898
Genome Map
Score = 1092 bits (568), Expect = 0.0
Identities = 624/639 (97%), Gaps = 7/639 (1%)
Strand = Plus / Plus
Query: 1 gagggccggtatgggacaccgggtgctgctggcttggaatatcagaagtacgaacaacaa 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 906 gagggccggtatgggacaccgggtgctgctggcttggaatatcagaagtacgaacaacaa 965
Query: 61 caacaactggaggatctggcggagtccgaggcaggagccgtcggtggagccagcaacaac 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 966 caacaactggaggatctggcggagtccgaggcaggagccgtcggtggagccagcaacaac 1025
Query: 121 aacggcgaatcgtcgtcgtccttgaaaaagctagaggatcagctgcacgccctcacctcg 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1026 aacggcgaatcgtcgtcgtccttgaaaaagctagaggatcagctgcacgccctcacctcg 1085
Query: 181 gacgagttgtacgaaaccctcaaggagtacgacgtcctgcaggacaagttccacacggtg 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1086 gacgagttgtacgaaaccctcaaggagtacgacgtcctgcaggacaagttccacacggtg 1145
Query: 241 ctgctgttgcccaaggaatcaaggcgtgaggttactgccggaggacgagatggatccgcc 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1146 ctgctgttgcccaaggaatcaaggcgtgaggttactgccggaggacgagatggatccgcc 1205
Query: 301 tacgtgctgcgctgcctgaagatgtggtacgagctgccctccgacgtcctgttctcggcc 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1206 tacgtgctgcgctgcctgaagatgtggtacgagctgccctccgacgtcctgttctcggcc 1265
Query: 361 atgagcctggtggaccgcttcctggatcgcatggccgtcaagccgaagcacatggcctgc 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1266 atgagcctggtggaccgcttcctggatcgcatggccgtcaagccgaagcacatggcctgc 1325
Query: 421 atgagcgtggcctcgttccacttggccatcaagcagctggacttgaaacccattcccgcc 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1326 atgagcgtggcctcgttccacttggccatcaagcagctggacttgaaacccattcccgcc 1385
Query: 481 gaggatctggttacaatatctcantgtggttgtaccgctggtgatctggaacgcaaggcc 540
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||
Sbjct: 1386 gaggatctggttacaatatctcagtgtggttgtaccgctggtgatctggaacgcatggcc 1445
Query: 541 ggcgtngattgccaacaaanctgggcgttcaagatgggacatgcaccgattaacntctgt 600
||||| |||||||||| || ||||||| || |||||||||||||||||| | || |||||
Sbjct: 1446 ggcgt-gattgccaac-aagctgggcg-tccagatgggacatgcaccga-tcacttctgt 1501
Query: 601 gagctacctggcgcatctactaangcccctcttccgcaa 639
||||||||| |||||||||||| |||||||||||||
Sbjct: 1502 gagctacct-gcgcatctactacg--ccctcttccgcaa 1537
\#
anon- EST:Liang-1.3  = ? something new ?
>anon- EST:Liang-1.3 
attagcctgc gagcaggcaa cagatggcac atcacatgca atccacatac ccccatacca
aaccatacca ttccatacta taccatcctc caatcctccg atcctccgat cttgcaatct
tggtgaactt gagcgcattg cgatgtgctc atatatttct tgctgctcgt tgaggatgat
gggaaaactc gtttttcgtt gcattcttcg gccggcgtca tcgatgatgc tgataatgat
aatgataatg acaatgataa taatgatgat aatattaaag aggttccatt ggcataagtc
cggctcgatg atgatcgcga tttgccttgg cacaacgcaa tgccaaagtt gttgtgccgg
ttgttgcctt ccagctccta tatatatata catacagata tactatgtac atatgttttt
tcttttattt tctttgtccg gggcactctt gtctcccggg ttccgttcta cagacgacct
taaggagggg gtcttgggag gccagtcggg agactggagc aaaccacatt tcgtattccg
tanacctggc gaaatattcg atnacatgcg attttcaaca accagaggac attgtttcta
ttgaaatata ataaaataag taaatatggt atgtaacang aaaaagttta agctttgatg
attgttttgt tacaanagag cacgtcttaa gaagttttta ttcaaggcaa aangacaaat
gagggccttt tttttttttt c
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003490 |gb|AE003490| arm:X  12354616..12657280
estimated- cyto:11B5-11D3  gadfly- seqname:AE003490 
 seq_release:3 
Length = 302665
Score = 431 bits (224), Expect = e-119 Genome Map
Identities = 224/224 (100%)
Strand = Plus / Minus
Query: 1 attagcctgcgagcaggcaacagatggcacatcacatgcaatccacatacccccatacca 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 268279 attagcctgcgagcaggcaacagatggcacatcacatgcaatccacatacccccatacca
268220
Query: 61 aaccataccattccatactataccatcctccaatcctccgatcctccgatcttgcaatct 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 268219 aaccataccattccatactataccatcctccaatcctccgatcctccgatcttgcaatct
268160
Query: 121 tggtgaacttgagcgcattgcgatgtgctcatatatttcttgctgctcgttgaggatgat 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 268159 tggtgaacttgagcgcattgcgatgtgctcatatatttcttgctgctcgttgaggatgat
268100
Query: 181 gggaaaactcgtttttcgttgcattcttcggccggcgtcatcga 224
||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 268099 gggaaaactcgtttttcgttgcattcttcggccggcgtcatcga 268056
Score = 394 bits (205), Expect = e-108 Genome Map
Identities = 258/271 (95%), Gaps = 7/271 (2%)
Strand = Plus / Minus
Query: 436 gtccggggcactcttgtctcccgggttccgttctacagacgaccttaaggagggggtctt 495
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 267838 gtccggggcactcttgtctcccgggttccgttctacagacgaccttaaggagggggtctt
267779
Query: 496 gggaggccagtcgggagactggagcaaaccacatttcgtattccgtanacctggcgaaat 555
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 267778 gggaggccagtcgggagactggagcaaaccacatttcgtattccgtacacctggcgaaat
267719
Query: 556 attcgatnacatgcgattttcaacaaccagaggacattgtttctattgaaatataataaa 615
||||||| |||||||||||||||||| |||| ||||||||||||||||||||||||||||
Sbjct: 267718 attcgatcacatgcgattttcaacaagcaga-gacattgtttctattgaaatataataaa
267660
Query: 616 ataagtaaatatggtatgtaacangaaaaagtttaagctttgatgattgttttgttacaa 675
|||||||||||| |||||||||| |||||| | |||||||||||||||||||| ||||
Sbjct: 267659 ataagtaaatat-gtatgtaacag--aaaagtat-agctttgatgattgttttgtaacaa
267604
Query: 676 nagagcacgtcttaagaagtttttattcaag 706
||||||||||||||| ||||||||||||||
Sbjct: 267603 \-agagcacgtcttaag-agtttttattcaag 267575
Score = 198 bits (103), Expect = 1e-49 Genome Map
Identities = 103/103 (100%)
Strand = Plus / Minus
Query: 275 ttaaagaggttccattggcataagtccggctcgatgatgatcgcgatttgccttggcaca 334
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 267999 ttaaagaggttccattggcataagtccggctcgatgatgatcgcgatttgccttggcaca
267940
Query: 335 acgcaatgccaaagttgttgtgccggttgttgccttccagctc 377
|||||||||||||||||||||||||||||||||||||||||||
Sbjct: 267939 acgcaatgccaaagttgttgtgccggttgttgccttccagctc 267897
\#
anon- EST:Liang-1.34  = ? something new ?
>anon- EST:Liang-1.34 
aaaacaaaac aaaacaaaaa cgacaaagca taaaaactgt atgttggttc ttttattata
ttatacttta tttctataaa tattattgta attgtactgt gtattatgat tttgctaacc
aaaatccctt agtatgagat gctcatcgat atttcacccc catacacaaa atcaaatcaa
ttcgaaccaa aaagaatact cggccatcca aacgaacaaa atttaccatt tattttgtac
gcaattgtaa ctacttttat atgtatgtac atatgtatgt acattctcta ttttggtacg
tccactgaaa caaaattata gtacgcctca tttgattttt caactgtctt gtgtttcata
cgatttaatt taatgatatt gattatgcaa atatatatat aaatataaac atcatttcta
ttgtaattaa aatgctgcag acaacaaaga cgaacgacaa aaactcatag aaaacacaan
aaaaacatct gaggagaagc cggagcggaa gaactggaaa gaattctccg cggggagggt
cactaccccc ctcgcgttct cctactccaa cactttctcc ctttacatcc aanttgggct
tccgtttaat cacgggattc ctcgggtgtt taattggttt tccctttttt tccncgccaa
ctttctcata aaaatcaaan gaatcaatca tcaagnccgc agatgggaga ag
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003527 |gb|AE003527| arm:3L  16253079..16532982
estimated- cyto:72E1-73A10  gadfly- seqname:AE003527 
 seq_release:3 
Length = 279904
Score = 987 bits (513), Expect = 0.0 Genome Map
Identities = 564/589 (95%), Gaps = 4/589 (0%)
Strand = Plus / Minus
Query: 37 ctgtatgttggttcttttattatattatactttatttctataaatattattgtaattgta 96
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 99748 ctgtatgttggttcttttattatattatactttatttctataaatattattgtaattgta 99689
Query: 97 ctgtgtattatgattttgctaaccaaaatcccttagtatgagatgctcatcgatatttca 156
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 99688 ctgtgtattatgattttgctaaccaaaatcccttagtatgagatgctcatcgatatttca 99629
Query: 157 cccccatacacaaaatcaaatcaattcgaaccaaaaagaatactcggccatccaaacgaa 216
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 99628 cccccatacacaaaatcaaatcaattcgaaccaaaaagaatactcggccatccaaacgaa 99569
Query: 217 caaaatttaccatttattttgtacgcaattgtaactacttttatatgtatgtacatatgt 276
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 99568 caaaatttaccatttattttgtacgcaattgtaactacttttatatgtatgtacatatgt 99509
Query: 277 atgtacattctctattttggtacgtccactgaaacaaaattatagtacgcctcatttgat 336
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 99508 atgtacattctctattttggtacgtccactgaaacaaaattatagtacgcctcatttgat 99449
Query: 337 ttttcaactgtcttgtgtttcatacgatttaatttaatgatattgattatgcaannnnnn 396
||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 99448 ttttcaactgtcttgtgtttcatacgatttaatttaatgatattgattatgcaaatatat 99389
Query: 397 nnnnnnnnnnnaacatcatttctattgtaattaaaatgctgcagacaacaaagacgaacg 456
|||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 99388 atataaatataaacatcatttctattgtaattaaaatgctgcagacaacaaagacgaacg 99329
Query: 457 acaaaaactcatagaaaacacaanaaaaacatctgaggagaagccggagcggaagaactg 516
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 99328 acaaaaactcatagaaaacacaaaaaaaacatctgaggagaagccggagcggaagaactg 99269
Query: 517 gaaagaattctccgcggggagggtcactacccccctcgcgttctcctactccaacacttt 576
| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 99268 g-aagaattctccgcgggga-ggtcactacccccctcgcgttctcctactccaacacttt 99211
Query: 577 ctccctttacatccaanttgggcttccgtttaatcacgggattcctcgg 625
|||||||||||||| | |||| |||||||||| |||| |||||||||||
Sbjct: 99210 ctccctttacatcc-agttggccttccgtttattcac-ggattcctcgg 99164
\#
anon- EST:Liang-1.38  == something new ?
>anon- EST:Liang-1.38 
aataactttt acaaaataca taccaaaaat acttaattaa atgcaagcag gtattttttc
aaataaaccg aatattccaa aaacacgttg cccaaataca cctacgatta attctaaagc
aaacaaaatg ctcatataca cgtagctact aatgtaataa aaagaacact aaacgaatcc
aaaacttaaa tcaggtattc acattttttt cgtattactt agactaagat aaagcgagtc
ggcgagccgc cagcctgact aaatgactaa aatcatcgtg agatgatttc aaagattttt
caaagatata aggaggatgt aaggaggagc gagcgttgca agacccacat atgtaactat
ttactaagcc acgttttata acaaacataa caacaaatcg atcgacgatg ctaaagcaaa
cggaatgaac tcttatcaaa atacaatttt gngtaatact tttaaaacga caaatgcaaa
naacaganng aaaaaaanaa acgaatgctg cggccgccga attccggtct ccctanagtg
agtcgtantt aatttcgata agccaagctg cattaangaa atcgggncaa ngcgcggggg
anaggcggtt tgcgtnattg gggcgctctt ccggnttnct ngctcantnn gactncnctg
cngcttnggt cgttngggct ggcggggaag c
Database: dmel_all_scaffolds_r310
gadfly| SEG:AE003841 |gb|AE003841| arm:2R  2310945..2577370
estimated- cyto:43A2-43D3  gadfly- seqname:AE003841 
 seq_release:3 
Length = 266426
Score = 898 bits (467), Expect = 0.0 Genome Map
Identities = 476/485 (98%)
Strand = Plus / Minus
Query: 1 aataacttttacaaaatacataccaaaaatacttaattaaatgcaagcaggtattttttc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 230552 aataacttttacaaaatacataccaaaaatacttaattaaatgcaagcaggtattttttc
230493
Query: 61 aaataaaccgaatattccaaaaacacgttgcccaaatacacctacgattaattctaaagc 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 230492 aaataaaccgaatattccaaaaacacgttgcccaaatacacctacgattaattctaaagc
230433
Query: 121 aaacaaaatgctcatatacacgtagctactaatgtaataaaaagaacactaaacgaatcc 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 230432 aaacaaaatgctcatatacacgtagctactaatgtaataaaaagaacactaaacgaatcc
230373
Query: 181 aaaacttaaatcaggtattcacannnnnnncgtattacttagactaagataaagcgagtc 240
||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 230372 aaaacttaaatcaggtattcacatttttttcgtattacttagactaagataaagcgagtc
230313
Query: 241 ggcgagccgccagcctgactaaatgactaaaatcatcgtgagatgatttcaaagattttt 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 230312 ggcgagccgccagcctgactaaatgactaaaatcatcgtgagatgatttcaaagattttt
230253
Query: 301 caaagatataaggaggatgtaaggaggagcgagcgttgcaagacccacatatgtaactat 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 230252 caaagatataaggaggatgtaaggaggagcgagcgttgcaagacccacatatgtaactat
230193
Query: 361 ttactaagccacgttttataacaaacataacaacaaatcgatcgacgatgctaaagcaaa 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 230192 ttactaagccacgttttataacaaacataacaacaaatcgatcgacgatgctaaagcaaa
230133
Query: 421 cggaatgaactcttatcaaaatacaattttgngtaatacttttaaaacgacaaatgcaaa 480
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 230132 cggaatgaactcttatcaaaatacaattttgagtaatacttttaaaacgacaaatgcaaa
230073
Query: 481 naaca 485
||||
Sbjct: 230072 aaaca 230068
\#
anon- EST:Liang-1.39  = no sequence data available
\#
anon- EST:Liang-1.4  = CG7977
>anon- EST:Liang-1.4 
ttttcatttc tttttctcnt aaaaatgnca cccaaaaagc caaccgaaaa atccgccaag
cctggcnaca anaacccata gcagaanaag actgctgngg ctcccgctgc cggcaagaan
gaggctgctc cctcggntgc caantcanct gccgctgcgc ccaagaaggc tgctgcccca
gcggctaata aggctgctcc ggncgccaaa aanccagcga ccgcnggtgc tgcngccaat
aagcccgcng ccgtnaagan gancgcggtc gccaaggcca atagcaagga tgccaaganc
aaggtcctcn ccggcaanaa nccccagtcc gtgctggcca anctctctgc caaggctcgc
gcggccgtca angccaaaaa cggcgttaag cccgtgacca agcccnccaa gggaacngcn
aaggccaagg ntgtggctct gctgaacgcc aagaangtcc agaagaagat atcaanggcn
ccttcngnac ccntgcccgc aagatncgca ccaacgtgca cttccgtcgg taaccaccct
gaagctgccc atggagtccc aagtacccca agnaaatcgg tgcccaccan gntaaccgca
tggaccgcgt taacatcatc aaagtaccac tgga
Database: dmel_all_transcript_r320
>CG7977-RA type=mRNA;
loc= 3L:complement (1647819..1648364,1648438..1648850,
1649225..1649306); ID=RpL23a-RA; name=RpL23a-RA;
db_xref='CG7977,FlyBase:FBgn0026372'; len=1041
Length = 1041
Genome Map
Score = 850 bits (442), Expect = 0.0
Identities = 548/607 (90%), Gaps = 6/607 (0%)
Strand = Plus / Plus
Query: 1 ttttcatttctttttctcntaaaaatgncacccaaaaagccaaccgaaaaatccgccaag 60
|||||||||||||||||| || ||||| ||||||||||||||||||| ||||||||||||
Sbjct: 28 ttttcatttctttttctcgtagaaatgccacccaaaaagccaaccgagaaatccgccaag 87
Query: 61 cctggcnacaanaacccatagcagaanaagactgctgnggctcccgctgccggcaagaan 120
|||||| |||| || ||| ||||||| |||||||||| |||||||||||||||||||||
Sbjct: 88 cctggcgacaagaagccagagcagaagaagactgctgcggctcccgctgccggcaagaag 147
Query: 121 gaggctgctccctcggntgccaantcanctgccgctgcgcccaagaaggctgctgcccca 180
|||||||||||||||| |||||| || ||||||||||||||||||||||||||||||||
Sbjct: 148 gaggctgctccctcggctgccaagccagctgccgctgcgcccaagaaggctgctgcccca 207
Query: 181 gcggctaataaggctgctccggncgccaaaaanccagcgaccgcnggtgctgcngccaat 240
|||||||| ||||||||||||| |||||| || ||||||||||| |||||||| |||||
Sbjct: 208 gcggctaagaaggctgctccggccgccaagaagccagcgaccgccggtgctgctgccaag 267
Query: 241 aagcccgcngccgtnaagangancgcggtcgccaaggccaatagcaaggatgccaaganc 300
|||||||| ||||| |||| || ||||| |||||||||||| ||||||||||||||||
Sbjct: 268 aagcccgcggccgtaaagacgaccgcggccgccaaggccaagagcaaggatgccaagaag 327
Query: 301 aaggtcctcnccggcaanaanccccagtccgtgctggccaanctctctgccaaggctcgc 360
||||||||| ||||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 328 aaggtcctcgccggcaagaagccccagtccgtgctggccaagctctctgccaaggctcgc 387
Query: 361 gcggccgtcaangccaaaaacggcgttaagcccgtgaccaagcccnccaagggaacngcn 420
||||||| ||| ||||| || ||||| |||||||||||||||||| |||||||||| ||
Sbjct: 388 gcggccgccaaggccaagaagggcgtgaagcccgtgaccaagcccgccaagggaaccgcc 447
Query: 421 aaggccaaggntgtggctctgctgaacgccaagaangtccagaagaagat-atcaanggc 479
|||||||||| |||||||||||||||||||||||| |||||||||||||| ||||| |||
Sbjct: 448 aaggccaaggctgtggctctgctgaacgccaagaaggtccagaagaagatcatcaagggc 507
Query: 480 nccttcngnacccntgcccgcaagatncgcaccaacgtgcacttccgtcgg-taaccacc 538
||||| | |||| |||||||||||| |||||||||||||||||||||||| |||||||
Sbjct: 508 gccttcggcacccgtgcccgcaagatccgcaccaacgtgcacttccgtcggccaaccacc 567
Query: 539 ctgaagctgcccatggagtcccaagtaccccaagnaaatcggtgcccaccangntaaccg 598
||||||||||||| ||||||||||||||||| || |||||||||||||||| | |||||
Sbjct: 568 ctgaagctgccca-ggagtcccaagtacccc-aggaaatcggtgcccaccagg--aaccg 623
Query: 599 catggac 605
|||||||
Sbjct: 624 catggac 630
\#
anon- EST:Liang-1.40  == ? not in genome
>anon- EST:Liang-1.40 
aaatntctnt nanatgggan tcgtttnatt cgnangnaan ggaattgg
Database: na_all.dros
377,099 sequences; 626,972,236 total letters
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 2,262,611
sequences; 10,883,439,008 total letters
If you have any problems or questions with the results of this search
please refer to the BLAST FAQs
No significant similarity found. For reasons why, click here.
\#
anon- EST:Liang-1.43  = CG5720
>anon- EST:Liang-1.43 
aaaagcgatg aatatgatga ggatctgttg aacttgagcg cgagggagga gtctgtagac
caggagccag aagaggatcc cccgaaattg gaggctccac cacgaaaagc taagagcccc
attattttta acagacgcga gaagacaccc gaaaagcgtc caaaggctga accggagatc
gattcccgcc aggaggaggc ggaggagaag agccccaaaa aagattcttc ggctgacaag
gccaaggaag accggtctga aaggcgatcg gtgcatgacc gtctcggttc aaagggccaa
acgccggcag atcgttcgca acgcaaccaa aaggagctct atgtgccgac ccatcggcga
cggagcgaac ccgaagccac caaagagcgc agtcaaagag agcgcacccg agaacgacgc
tccagccgcg atactctaag gacactaacc gtaatcaacg ccancgtcgt tcgcctaatc
cgggagggtc caagtacaaa agcaacgcat tgtctcccaa gttattgttg gccgtttaca
agccaccgga gcccgtcgga cgatgaagga tttggccgaa aaaaccaant caactccgtt
aataaaggnc aaacccanga ncaaatnttt ctcccaaaaa naanaggctg caagaaaact
cctggtgcga acaatngggg gnngcncaaa ngtttcaaaa tnctcgncaa aganttntga
cncaaaaagg ggggaccang gatttnggca aanattnana aattc
Database: dmel_all_transcript_r320
>CG5720-RA type=mRNA;
loc= 3R:complement (20131027..20131577,20131639..20131908,
20131971..20134220,20134275..20134500,
20134594..20134799); ID=CG5720-RA; name=CG5720-RA;
db_xref='CG5720,FlyBase:FBgn0028471'; len=3503
Length = 3503
Genome Map
Score = 975 bits (507), Expect = 0.0
Identities = 606/636 (95%), Gaps = 10/636 (1%)
Strand = Plus / Plus
Query: 2 aaagcgatgaatatgatgaggatctgttgaacttgagcgcgagggaggagtctgtagacc 61
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 859 aaagcgatgaatatgatgaggatctgttgaacttgagcgcgagggaggagtctgtagacc 918
Query: 62 aggagccagaagaggatcccccgaaattggaggctccaccacgaaaagctaagagcccca 121
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 919 aggagccagaagaggatcccccgaaattggaggctccaccacgaaaagctaagagcccca 978
Query: 122 ttatttttaacagacgcgagaagacacccgaaaagcgtccaaaggctgaaccggagatcg 181
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 979 ttatttttaacagacgcgagaagacacccgaaaagcgtccagaggctgaaccggagatcg 1038
Query: 182 attcccgccaggaggaggcggaggagaagagccccaaaaaagattcttcggctgacaagg 241
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1039 attcccgccaggaggaggcggaggagaagagccccaaaaaagattcttcggctgacaagg 1098
Query: 242 ccaaggaagaccggtctgaaaggcgatcggtgcatgaccgtctcggttcaaagggccaaa 301
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 1099 ccaaggaagaccggtctgaaaggcgatcggtgcatgaccgtctcggttcaaaggcccaaa 1158
Query: 302 cgccggcagatcgttcgcaacgcaaccaaaaggagctctatgtgccgacccatcggcgac 361
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1159 cgccggcagatcgttcgcagcgcaaccaaaaggagctctatgtgccgacccatcggcgac 1218
Query: 362 ggagcgaacccgaagccaccaaagagcgcagtcaaagagagcgcacccgagaacgacgct 421
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1219 ggagcgaacccgaggccaccaaagagcgcagtcaaagagagcgcacccgagaacgacgct 1278
Query: 422 ccagccgcgata-ctctaaggacactaaccgtaatcaacgccancgtcgttcgcctaatc 480
|||||||||||| ||||| |||||||||||||||||| ||||| ||||||||||||| ||
Sbjct: 1279 ccagccgcgatacctctagggacactaaccgtaatcagcgccagcgtcgttcgcctagtc 1338
Query: 481 cgggagggtccaagtacaaaagcaacgcattgtctcccaagttattgttggccgtttaca 540
| ||||| ||||||||| ||||||||||||||||||||||||||||| |||||||| |||
Sbjct: 1339 c-ggaggctccaagtac-aaagcaacgcattgtctcccaagttattg-tggccgttaaca 1395
Query: 541 agccaccggagcccgtcggacgatgaaggatttggccgaaaaaaccaantcaactccgtt 600
||||||||||| ||||||||||||| ||||| |||||| |||| | | |||||||||||
Sbjct: 1396 agccaccggag-ccgtcggacgatg-aggatatggccg--aaaagccagtcaactccgtt 1451
Query: 601 aataaaggncaaacccangancaaatntttctccca 636
|| |||| | || ||| || ||||| |||||||||
Sbjct: 1452 \-attaaggtc-aagccaagaccaaatgtttctccca 1485
\#
anon- EST:Liang-1.52  = CG3998
>anon- EST:Liang-1.52 
actcgccagc agcgcattgg cgttttttca ttttttaaag tgtacttaag agttgttaat
atttttcgca gtgctcggcc cgaccacaac aaacaataat agccgaataa tagtgtgagt
gaaaatgcgg cgagctgcat tcggcgcaaa accaagtgtt ccgcagcacc caaagcccaa
atcgaacaac tcgaaatcgg aatcaggcga agccatcatt agcgagacat ttgtatttgt
ctgacccctc aacggtgtct gagaatctcg gagagtcgtc gtggagcggt gtggagagga
gagagcagga gcagaaaagg gcccacaatc caagtccaag gaagcaccac tccgatactg
caccgatatg gaaaccgagt cgatggctcc aagcagcagt gcggcggctg cagccaccaa
gctcctggtg gagatnacca ccgacgggaa taccaagctg cactgcccgg tgtgcaacaa
agngctggtc tccctaaccg gatatgtgaa agcacgttaa ggaagcacca gccgncgggc
ggnttcnagt tgccgtcact gcgatgctcc ggttttgcca cgaaggaggg agctnaccca
gcnatgcaaa ggnatnanca agggggtcac tgggggccgg taactgggnc agggagccaa
aagccntttc ntttgttaaa aaattgcggg cngggntana agttncaagg aggnataacc
nttngccact ggaaggncca aatttttggn gaagga
Database: dmel_all_transcript_r320
>CG3998-RA type=mRNA;
loc= 2L:join (9750567..9750982,9751909..9752282,
9752350..9753728,9753794..9754606); ID=zf30C-RA;
name=zf30C-RA; db_xref='CG3998,FlyBase:FBgn0022720';
len=2982
Length = 2982
Genome Map
Score = 929 bits (483), Expect = 0.0
Identities = 574/612 (93%), Gaps = 7/612 (1%)
Strand = Plus / Plus
Query: 1 actcgccagcagcgcattggcgnnnnnnnnnnnnnnaaagtgtacttaagagttgttaat 60
||||||||||||| |||||||| ||||||||||||||||||||||||
Sbjct: 46 actcgccagcagctcattggcgttttttcattttttaaagtgtacttaagagttgttaat 105
Query: 61 atttttcgcagtgctcggcccgaccacaacaaacaataatagccgaataatagtgtgagt 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 106 atttttcgcagtgctcggcccgaccacaacaaacaataatagccgaataatagtgtgagt 165
Query: 121 gaaaatgcggcgagctgcattcggcgcaaaaccaagtgttccgcagcacccaaagcccaa 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 166 gaaaatgcggcgagctgcattcggcgcaaaaccaagtgttccgcagcacccaaagcccaa 225
Query: 181 atcgaacaactcgaaatcggaatcaggcgaagccatcattagcgagacatttgtatttgt 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 226 atcgaacaactcgaaatcggaatcaggcgaagccatcattagcgagacatttgtatttgt 285
Query: 241 ctgacccctcaacggtgtctgagaatctcggagagtcgtcgtggagcggtgtggagagga 300
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 286 ctgacccctcagcggtgtctgagaatctcggagagtcgtcgtggagcggtgtggagagga 345
Query: 301 gagagcaggagcagaaaagggcccacaatccaagtccaaggaagcaccactccgatactg 360
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 346 gagagcaggagcagaaaagggcccacaatccaagtccaaggaagcaccactccgataccg 405
Query: 361 caccgatatggaaaccgagtcgatggctccaagcagcagtgcggcggctgcagccaccaa 420
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 406 aaccgatatggaaaccgagtcgatggctccaagcagcagtgcggcggctgcagccaccaa 465
Query: 421 gctcctggtggagatnaccaccgacgggaataccaagctgcactgcccggtgtgcaacaa 480
||||||||||||||| ||||||||||| | ||||||||||||||||||||||||||||
Sbjct: 466 gctcctggtggagatcaccaccgacggaatacccaagctgcactgcccggtgtgcaacaa 525
Query: 481 agngctggtctccctaaccggatatgtgaaagcacgttaaggaagcaccagccgncgggc 540
| ||||||||||||| ||||||||||| ||||||| ||| ||||||||||||| |||||
Sbjct: 526 ggcgctggtctccctagccggatatgtg-aagcacg-taaagaagcaccagccgccgggc 583
Query: 541 ggnttcnagttgccgtcactgcgatgctccggttttgccacgaaggagggagctnaccca 600
|| ||| || |||||||||||||||||| ||||||||||||| |||| |||||| |||||
Sbjct: 584 ggcttcgag-tgccgtcactgcgatgct-cggttttgccacg-agga-ggagctcaccca 639
Query: 601 gcnatgcaaagg 612
|| |||||||||
Sbjct: 640 gc-atgcaaagg 650
\#
anon- EST:Liang-1.53  = looks like bacterial plasmid seq to me
>anon- EST:Liang-1.53 
aaaaaaaaaa aacgaatgct gcggccgccg aattccggtc tccctatagt gagtcgtatt
aatttcgata agccagctgc attaatgaat cggccaacgc gcggggagag gcggtttgcg
tattgggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg
gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa
cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc
gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc
aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag
ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct
cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta
ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttnagcccg accgctgcgc
cttanccggt aactancgtc ttgagtccaa cccggttaag acacgactta tcgccactgg
gcagcagcca atggtaacan ggattaagca naaccnaggt aattnaggcg ggtgctanan
aanttcttga antgggtggc ctaactac
Database: na_all.dros
>gi||gb|X01803|ATPG418 Transposable P vector conferring G418
resistance in Drosophila. (06-JUL-2002)
Length = 5073
Score = 1104 bits (574), Expect = 0.0
Identities = 599/608 (98%), Gaps = 2/608 (0%)
Strand = Plus / Plus
Query: 72 gccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgct 131
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 911 gccagctggattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgct 970
Query: 132 cttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtat 191
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 971 cttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtat 1030
Query: 192 cagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaaga 251
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1031 cagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaaga 1090
Query: 252 acatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgt 311
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1091 acatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgt 1150
Query: 312 ttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggt 371
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1151 ttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggt 1210
Query: 372 ggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgc 431
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1211 ggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgc 1270
Query: 432 gctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaa 491
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1271 gctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaa 1330
Query: 492 gcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgct 551
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1331 gcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgct 1390
Query: 552 ccaagctgggctgtgtgcacgaaccccccgttnagcccgaccgctgcgccttanccggta 611
|||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 1391 ccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggta 1450
Query: 612 actancgtcttgagtccaacccggttaagacacgacttatcgccactgggcagcagccaa 671
|||| ||||||||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 1451 actatcgtcttgagtccaacccgg-taagacacgacttatcgccact-ggcagcagccac 1508
Query: 672 tggtaaca 679
||||||||
Sbjct: 1509 tggtaaca 1516
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 2,262,611
sequences; 10,883,439,008 total letters
Score E
Sequences producing significant alignments: (bits) Value
gi|31414875|gb|AY260554.1| Retrotransposon vector MEL/ELM, ... 1233 0.0
gi|31414872|gb|AY260553.1| Retrotransposon vector ELM 5, co... 1233 0.0
gi|58199|emb|X65302.1|CVPGEM3 Cloning vector pGEM-3 1233 0.0
gi|58196|emb|X65300.1|CVPGEM1 Cloning vector pGEM-1 1233 0.0
gi|3142442|gb|AF062998.1|AF062998 Retrotransposon vector pV... 1233 0.0
gi|3142439|gb|AF062997.1|AF062997 Retrotransposon vector pV... 1233 0.0
gi|3142436|gb|AF062996.1|AF062996 Retrotransposon vector pV... 1233 0.0
gi|310816|gb|L08951.1|SYNPT7T318 pT7T318 cloning vector 1233 0.0
gi|310773|gb|L08872.1|SYNPGEM3V pGEM3 cloning vector Gemini... 1233 0.0
gi|310771|gb|L08870.1|SYNPGEM1V pGEM1 cloning vector Gemini... 1233 0.0
gi|58197|emb|X65301.1|CVPGEM2 Cloning vector pGEM-2 1225 0.0
gi|310772|gb|L08871.1|SYNPGEM2V pGEM2 cloning vector Gemini... 1225 0.0
gi|58205|emb|X65303.1|CVPGEM4 Cloning vector pGEM-4 1225 0.0
gi|310845|gb|L08948.1|SYNSP6T719 pSP6T719 cloning vector 1217 0.0
gi|310817|gb|L08952.1|SYNPT7T319 pT7T319 cloning vector 1217 0.0
gi|34105724|gb|AY336796.1| Transformation vector pICon, com... 1148 0.0
gi|32140408|gb|AY301066.1| Transposition vector RescueMu, c... 1148 0.0
gi|31747150|gb|AY279346.1| Gene silencing vector pMTCbLCVA.... 1148 0.0
gi|31747149|gb|AY279345.1| Gene silencing vector pCPCbLCVA.... 1148 0.0
gi|31747148|gb|AY279344.1| Gene silencing vector pCPCbLCVB.... 1148 0.0
gi|31580803|gb|AY297714.1| Yeast truncation assay backbone ... 1148 0.0
gi|20454202|gb|AF502128.1| Transient expression vector pBI2... 1148 0.0
gi|23506937|gb|AY157312.1| Cloning vector YDp-W, complete s... 1148 0.0
gi|23506935|gb|AY157311.1| Cloning vector YDp-U, complete s... 1148 0.0
gi|23506933|gb|AY157310.1| Cloning vector YDp-L, complete s... 1148 0.0
gi|23506931|gb|AY157309.1| Cloning vector YDp-K, complete s... 1148 0.0
gi|23506929|gb|AY157308.1| Cloning vector YDp-H, complete s... 1148 0.0
gi|22347652|gb|AF531173.1| Cloning vector pDblet, complete ... 1148 0.0
gi|47420069|gb|AY603762.1| Cloning vector pLucFXR, complete... 1148 0.0
gi|47420067|gb|AY603761.1| Cloning vector pLucLRH-1, comple... 1148 0.0
etc etc
\#
anon- EST:Liang-1.56  = CG7808
>anon- EST:Liang-1.56 
ttttctcgct ttttactcga acatgggtat tagccgcgat agtgcacaca aacgccgggc
caccggaggc aagcgcaagt cgctccgcaa gaagcgcaag ttcgagttgg gacgccccgc
cgccaacacc aagcttggct ccggccgcgt gcacaaggtg cgcacccgtg gtggaaacac
caagctccgt gctctgcgcc tggaaaccgg aaacttcgcc tgggcctccg agggagtggc
gcgcaagacc cgtatcgccg atgttgtgta caacgcctcc aacaacgagc tggtgcgaac
caagaccttg gtgaagaaca gcatcgtggt catcgatgcc acgcccttcc gccagtggta
cgaggctcac tacgtgctgc ccctgggacg caagcgtaac cccaagcacg cccagaagga
ggacgagaac gacgtgctga ccaagaagcg cagcgaaaag gttatgaaga agtactggag
cgccaaaagt acggcaaggt cgaacaaggc ctcgaggata attcaactcc gggcgcatcn
tgggttgcat ttcttccgcc ccgganatnc ggtcgctccg aangggtaaa atttggaang
naaaggantt ggaattcaac ntaagaagnn taagnttaaa gaaataaggn actanataaa
ccttgaaaga cattgatttt gaaacaaaaa acngggataa aanaacttgg ttttttaaag
gaagtgcatt
Database: dmel_all_transcript_r320
>CG7808-RC type=mRNA;
loc= 3R:join (25676955..25677022,25677287..25677393,
25677873..25678284,25678503..25678717); ID=CG7808-RC;
name=CG7808-RC; db_xref='CG7808,FlyBase:FBgn0039713';
len=802
Length = 802
Genome Map
Score = 1035 bits (538), Expect = 0.0
Identities = 682/734 (92%), Gaps = 12/734 (1%)
Strand = Plus / Plus
Query: 2 tttctcgctttttactcgaacatgggtattagccgcgatagtgcacacaaacgccgggcc 61
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 44 tttctcgctttttactcgaacatgggtattagccgcgatagtgcacacaaacgccgggcc 103
Query: 62 accggaggcaagcgcaagtcgctccgcaagaagcgcaagttcgagttgggacgccccgcc 121
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 104 accggaggcaagcgcaagtcgctccgcaagaagcgcaagttcgagttgggacgccccgcc 163
Query: 122 gccaacaccaagcttggctccggccgcgtgcacaaggtgcgcacccgtggtggaaacacc 181
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 164 gccaacaccaagcttggctccggccgcgtgcacaaggtgcgcacccgtggtggaaacacc 223
Query: 182 aagctccgtgctctgcgcctggaaaccggaaacttcgcctgggcctccgagggagtggcg 241
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 224 aagctccgtgctctgcgcctggaaaccggaaacttcgcctgggcctccgagggagtggcg 283
Query: 242 cgcaagacccgtatcgccgatgttgtgtacaacgcctccaacaacgagctggtgcgaacc 301
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 284 cgcaagacccgtatcgccgatgttgtgtacaacgcctccaacaacgagctggtgcgaacc 343
Query: 302 aagaccttggtgaagaacagcatcgtggtcatcgatgccacgcccttccgccagtggtac 361
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 344 aagaccttggtgaagaacagcatcgtggtcatcgatgccacgcccttccgccagtggtac 403
Query: 362 gaggctcactacgtgctgcccctgggacgcaagcgtaaccccaagcacgcccagaaggag 421
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 404 gaggctcactacgtgctgcccctgggacgcaagcgtaaccccaagcacgcccagaaagag 463
Query: 422 gacgagaacgacgtgctgaccaagaagcgcagcgaaaaggttatgaagaagta-ctggag 480
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 464 gacgagaacgacgtgctgaccaagaagcgcagcgaaaaggttatgaagaagtacctggag 523
Query: 481 cgccaaaagtacggcaaggtcgaacaaggcctcgaggat-aattcaactccgggcgcatc 539
||||| ||||||||||||||||| || | |||||||||| | |||| |||||| ||||||
Sbjct: 524 cgccagaagtacggcaaggtcgagcaggccctcgaggatcagttcacctccggccgcatc 583
Query: 540 ntgggttgcatttctt-ccgccccggana-tncggtcgctccgaangggtaaaatttgga 597
||| ||||||||||| |||||||||| | | ||||||||||| | || || | ||||||
Sbjct: 584 ttggcttgcatttcttcccgccccggacagtgcggtcgctccg-acggctacattttgga 642
Query: 598 angnaaagganttggaattc-aacntaagaagnntaagnttaaagaaataaggnactana 656
| | ||||| ||||||||| | | ||||||| ||| ||| || |||| |||| |
Sbjct: 643 aggc-aaggagttggaattctaccttaagaagatcaagtctaagaaataaaggcactaga 701
Query: 657 taaaccttgaaagacattgattttgaaacaaaaaacngggataaaanaacttggtttttt 716
| || |||| |||||| |||||| ||||||||| || |||||| ||||| |||||||
Sbjct: 702 t-aagcttgcaagaca-tgatttgcaaacaaaaa--cggaataaaacaactt-gtttttt 756
Query: 717 aaaggaagtgcatt 730
| ||||||||||||
Sbjct: 757 ataggaagtgcatt 770
\#
anon- EST:Liang-1.62  no sequence data available
\#
anon- EST:Liang-1.66  = CG4978
>anon- EST:Liang-1.66 
gaccaggtgc ccgtgggcca cattccgcgc agcatgacca tcatgtgcag gggtgaggtc
actcgaatgg cccagcctgg ggatcacatt gtggtctctg gagtgttctt gccactgatg
cgcacaggtt tcgctcagat gattcagggt ttgctctcgg agacattcct tcaagctcac
cgcatcatct gtatcaacaa gaacgacgag atttcggaca aggatgccga gctgactcca
gaagagctgg aggaattggc ccaggatgac ttctacgagc gcttggccac cagcttggca
cccgaaatct atggccattt ggatgttaag aaagcgctgc tcttgctgtt ggtcggagga
gttgacaagc ggcccgatgg catgaagatt cgtggcaaca tcaacatctg cctgatggga
gatcccggtg tggccaagtc gcaactgctg ggctacatta gccgattggc cgtgcgatcg
cagtacacca caggacgaag ttcttcgggg gtgggtctca cgctgcggtc atgaaggatc
ccctcacagg cgaaatgact tggaaggaag actcttgtgc tggctgatca gggatctgct
gcattgataa ttcacaaatg gcggatcagg atcttacacc ttcatagtga tggaacacaa
accatttcat accaaaagca ggctctacaa cctaaacctc ctttcaatcc tgggccgctg
ctaatccccc ttttggaacc taccatcctc cttcctacc
Database: dmel_all_transcript_r320
>CG4978-RA type=mRNA;
loc= 3L:join (8850320..8850489,8850554..8850923,
8850995..8851496,8851564..8852621,8852684..8853045);
ID=Mcm7-RA; name=Mcm7-RA;
db_xref='CG4978,FlyBase:FBgn0020633'; len=2462
Length = 2462
Genome Map
Score = 1063 bits (553), Expect = 0.0
Identities = 626/645 (97%), Gaps = 7/645 (1%)
Strand = Plus / Plus
Query: 1 gaccaggtgcccgtgggccacattccgcgcagcatgaccatcatgtgcaggggtgaggtc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 863 gaccaggtgcccgtgggccacattccgcgcagcatgaccatcatgtgcaggggtgaggtc 922
Query: 61 actcgaatggcccagcctggggatcacattgtggtctctggagtgttcttgccactgatg 120
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 923 actcgaatggcccagcctggggatcacattgtggtctctggagtgttcttgccactaatg 982
Query: 121 cgcacaggtttcgctcagatgattcagggtttgctctcggagacattccttcaagctcac 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 983 cgcacaggtttcgctcagatgattcagggtttgctctcggagacattccttcaagctcac 1042
Query: 181 cgcatcatctgtatcaacaagaacgacgagatttcggacaaggatgccgagctgactcca 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1043 cgcatcatctgtatcaacaagaacgacgagatttcggacaaggatgccgagctgactcca 1102
Query: 241 gaagagctggaggaattggcccaggatgacttctacgagcgcttggccaccagcttggca 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1103 gaagagctggaggaattggcccaggatgacttctacgagcgcttggccaccagcttggca 1162
Query: 301 cccgaaatctatggccatttggatgttaagaaagcgctgctcttgctgttggtcggagga 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1163 cccgaaatctatggccatttggatgttaagaaagcgctgctcttgctgttggtcggagga 1222
Query: 361 gttgacaagcggcccgatggcatgaagattcgtggcaacatcaacatctgcctgatggga 420
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 1223 gttgacaagcggcccgatggcatgaagattcgtggcaacattaacatctgcctgatggga 1282
Query: 421 gatcccggtgtggccaagtcgcaactgctgggctacattagccgattggccgtgcgatcg 480
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 1283 gatcccggtgtggccaagtcgcagctgctgggctacattagccgattggccgtgcgatcg 1342
Query: 481 cagtacaccacaggacgaagttcttcgggggtgggtctca-cgctgcggtcatgaaggat 539
|||||||||||||| ||| ||||||||||||||||||| | ||||||||||||||||||
Sbjct: 1343 cagtacaccacagggcgaggttcttcgggggtgggtcttaccgctgcggtcatgaaggac 1402
Query: 540 cccctcacaggcgaaatgac-ttggaaggaaga-ctcttgtgctggctgatcaggga-tc 596
|| ||||||||||| ||||| ||||||||| || ||||||||||||||||||||||| ||
Sbjct: 1403 cctctcacaggcgagatgacattggaaggaggagctcttgtgctggctgatcagggagtc 1462
Query: 597 tgctgcattgat-aattc-acaa-atggcggatcaggatcttaca 638
|||||||||||| | ||| |||| |||||||||||||||| ||||
Sbjct: 1463 tgctgcattgatgagttcgacaagatggcggatcaggatcgtaca 1507
\#
anon- EST:Liang-1.72  = CG12011
>anon- EST:Liang-1.72 
acagttcaac tgaaaccctc atcatgcatt ctctacgact cctggttctt cttggtgttc
tgatggccac tcagggcaga gtcctagaac aggacaagac tccggaggtt gtcggttcaa
ctcaagaaat caaaccaaac gtggaggtca agcaggaagt tgccaataaa gtgccggaaa
cccagccgaa gctgggtggc gctgtcatct cccaaggcca atcttctgca gctatcgatc
aggttggtgt gaaggagggt caagatcagg tggcgaactc cacaactcct gatgtccagg
aaagccaacg cgaaggggtt tctttcgtcg aagtgactaa agaaaaccag gaagcacatg
ccccactgag taaggtcgtc agtagccagt agccccagcg atagccgagg aaaagcagcc
cacttccaat gagataccca aggaccaagg agccacgcaa agaagttata acccagaact
atcccgacgt ccagggacgc gacaataaga ttcagttggt gttcgagcaa cctggtcaaa
accaaaacca agattccaca gataagcatt caggatttgg gagaaagatt ttcaagtatc
anggagtgca aattggtcaa cgggatntca atcaatttaa accagtatcc gagcatctac
aaacaanntt ccattcttta cccgaaaggg tggaaaaant tttctgtggg taaaaaaaac
cggatgccaa t
Database: dmel_all_transcript_r320
>CG12011-RA type=mRNA;
loc= 3L:join (1675248..1675273,1675346..1677049); Genome Map
ID=CG12011-RA; name=CG12011-RA;
db_xref='CG12011,FlyBase:FBgn0035257'; len=1730
Length = 1730
Score = 1035 bits (538), Expect = 0.0
Identities = 634/663 (95%), Gaps = 9/663 (1%)
Strand = Plus / Plus
Query: 1 acagttcaactgaaaccctcatcatgcattctctacgactcctggttcttcttggtgttc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 acagttcaactgaaaccctcatcatgcattctctacgactcctggttcttcttggtgttc 60
Query: 61 tgatggccactcagggcagagtcctagaacaggacaagactccggaggttgtcggttcaa 120
|||||||||||||||||||||| ||||||||||||||| ||||||||||||||| ||||
Sbjct: 61 tgatggccactcagggcagagttctagaacaggacaaggctccggaggttgtcgcttcac 120
Query: 121 ctcaagaaatcaaaccaaacgtggaggtcaagcaggaagttgccaataaagtgccggaaa 180
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 121 ctcaagaaatcaaacccaacgtggaggtcaagcaggaagttgccaataaagtgcgggaaa 180
Query: 181 cccagccgaagctgggtggcgctgtcatctcccaaggccaatcttctgcagctatcgatc 240
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 cccagccgcagctgggtggcgctgtcatctcccaaggccaatcttctgcagctatcgatc 240
Query: 241 aggttggtgtgaaggagggtcaagatcaggtggcgaactccacaactcctgatgtccagg 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 aggttggtgtgaaggagggtcaagatcaggtggcgaactccacaactcctgatgtccagg 300
Query: 301 aaagccaacgcgaaggggtttctttcgtcgaagtgactaaagaaaaccaggaagcacatg 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301 aaagccaacgcgaaggggtttctttcgtcgaagtgactaaagaaaaccaggaagcacatg 360
Query: 361 ccccactgagtaaggtcgtcagtag-ccagtagccccagcgatagccgaggaaaagcagc 419
||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||
Sbjct: 361 ccccactgagtaaggtcgtcagtagcccattagccccagcgatagccgaggaaaagcagc 420
Query: 420 ccacttccaatgagatacccaaggaccaaggagccacgcaaagaagttataacccagaac 479
||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||
Sbjct: 421 ccacttccaatgagatacccaaggacc-aggagccaggcaaagaagttataacccagaac 479
Query: 480 tatcccgacgtccagggacgcgacaataagattcagttggtgttcgagcaacctggtcaa 539
||||||||||||| ||||||||||||||||||||||| |||| |||||| |||||||||
Sbjct: 480 catcccgacgtccaaggacgcgacaataagattcagtttgtgtacgagcagcctggtcaa 539
Query: 540 aaccaaaaccaagattccacagataagcattcaggatttgggagaaagattttcaagtat 599
|||||||||| |||||||||||||||||||||||||| | |||| ||||| |||||||||
Sbjct: 540 aaccaaaacc-agattccacagataagcattcaggatct-ggag-aagatcttcaagtat 596
Query: 600 canggagtgcaaattggtcaacgggatntcaatcaatttaaaccagtatccgagcatcta 659
|| ||||||| || |||||||| |||| ||||||| || ||||||||||||||||||||
Sbjct: 597 cagggagtgc-aagtggtcaac-ggatctcaatca--tttaaccagtatccgagcatcta 652
Query: 660 caa 662
|||
Sbjct: 653 caa 655
\#
anon- EST:Liang-1.74  = CG14938
>anon- EST:Liang-1.74 
ttttctacat ttttgaaatg tgtgccaggc ggcgcgtgac tttgtttggg tcgatcgata
tggtttttgt gatatccgat tgttccttag ctgcgctcag tgaatcaaat ggatccgaag
accaatccgt ctcaggcaat tttctcgcta gacacttaaa gttaaggggt ttttgttgcc
gtaaccagca gaagcgcacc atcttgtatt tttattgtgt tttgactaag ttatgattat
atccatatgg agcgacattc atagaaagca tcctcatcat acataaacat atgcagatat
gcataggcat acaattataa tatatactta tagtttgtaa ataacacgca acaagaccct
tggaaatcta tcgaaaatta ttatcacaac tgtattattt ttgcattttc caaggaggaa
cattaataac gagctaacgc gcgaaaactt tcacatatat tggccaagtg tagtccttaa
cccagtttac aatatatcga gccctgaaag tggggctgtg atgattatga gatatatata
caattatatg acagtggaaa cagaagcagc ataacggnag acccaactaa cgaaaataat
gaaaagggat taaacaaaca agttattana tttaatgtta ggttgaacta ctaaaagnta
atgattgaaa agcacggggt ntaaagggat ggngaanagg agttcccgcn tgggaatgcg
aatagntttt anttggggcg c
Database: dmel_all_transcript_r320
>CG14938-RD type=mRNA;
loc= 2L:complement (11783198..11786612,11786700..11786912,
11787536..11788021,11788106..11788273,11791158..11792545,
11792656..11792769,11794919..11795028,
11797997..11798304); ID=crol-RD; name=crol-RD;
db_xref='CG14938,FlyBase:FBgn0020309'; len=6202
Length = 6202
Genome Map
Score = 1248 bits (649), Expect = 0.0
Identities = 715/737 (97%), Gaps = 7/737 (0%)
Strand = Plus / Plus
Query: 1 ttttctacatttttgaaatgtgtgccaggcggcgcgtgactttgtttgggtcgatcgata 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4076 ttttctacatttttgaaatgtgtgccaggcggcgcgtgactttgtttgggtcgatcgata 4135
Query: 61 tggtttttgtgatatccgattgttccttagctgcgctcagtgaatcaaatggatccgaag 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4136 tggtttttgtgatatccgattgttccttagctgcgctcagtgaatcaaatggatccgaag 4195
Query: 121 accaatccgtctcaggcaattttctcgctagacacttaaagttaaggggtttttgttgcc 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4196 accaatccgtctcaggcaattttctcgctagacacttaaagttaaggggtttttgttgcc 4255
Query: 181 gtaaccagcagaagcgcaccatcttgtatttttattgtgttttgactaagttatgattat 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4256 gtaaccagcagaagcgcaccatcttgtatttttattgtgttttgactaagttatgattat 4315
Query: 241 atccatatggagcgacattcatagaaagcatcctcatcatacataaacatatgcagatat 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4316 atccatatggagcgacattcatagaaagcatcctcatcatacataaacatatgcagatat 4375
Query: 301 gcataggcatacaattataatatatacttatagtttgtaaataacacgcaacaagaccct 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4376 gcataggcatacaattataatatatacttatagtttgtaaataacacgcaacaagaccct 4435
Query: 361 tggaaatctatcgaaaattattatcacaactgtattatttttgcattttccaaggaggaa 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4436 tggaaatctatcgaaaattattatcacaactgtattatttttgcattttccaaggaggaa 4495
Query: 421 cattaataacgagctaacgcgcgaaaactttcacatatattggccaagtgtagtccttaa 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4496 cattaataacgagctaacgcgcgaaaactttcacatatattggccaagtgtagtccttaa 4555
Query: 481 cccagtttacaatatatcgagccctgaaagtggggctgtgatgattatgagatatatata 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4556 cccagtttacaatatatcgagccctgaaagtggggctgtgatgattatgagatatatata 4615
Query: 541 caattatatgacagtggaaacagaagcagcataacggnagacccaactaacgaaaataat 600
||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||||
Sbjct: 4616 caattatatgacagtggaaacagaagcagcataacggcagacccaactaacgaga-taat 4674
Query: 601 gaaaagggattaaacaaacaagttattanatttaatgttaggttgaactactaaaagnta 660
|||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| ||
Sbjct: 4675 gaaaagggattaaacaaacaagttattatatttaatgttag-ttgaactactaaaag-ta 4732
Query: 661 atgattgaaaagcacggggtntaaagggatggngaanaggagttcccgcntgggaatgcg 720
|||||||||| |||||| |||| |||| || |||||||||||| ||||| ||||
Sbjct: 4733 atgattgaaa-gcacggatcg--aaggaatggaga-taggagttcccgcgtgggagtgcg 4788
Query: 721 aatagnttttanttggg 737
| ||| ||||| |||||
Sbjct: 4789 agtagtttttagttggg 4805
\#
anon- EST:Liang-1.75  = CG5481
>anon- EST:Liang-1.75 
agcaacaggc gcagcagccg caccagcaac accaggctct ccagcagcac cagcaactgc
cacccagcaa catctaccag cagatgtcca ccaccagcga gatatacccc acgaacacgg
gtccttcgcg ctctgtctac tctgagcagt attactaccc caaggacaag cagagacaca
tccacatcac cgagaacaag ctgagcaact gccacaccta tgaggcggct cctggcgcca
agcagtcctc gccgatatcc tcgcagttcg ccagcgtgag gcggcagcag ctgccgccca
actgcagcat cggcagggaa agtgcccgct tcaaggtgct aaacacggat cagggcaaga
accagcagaa tctcctggat ctcgacggct cctcgatgtg ctacaacggt ctggcagact
cgggctgcgg tggatctccc tccccgatgg ccatgctgat gtcgcacgag gacgagcacg
cgctgtacca cacggcggat ggggatctgg acgacatgga acgactgtac gtcaaggtgg
acgagcagca gcctccgcag cagcagcagc agctgatacc ctagttccac agcatccggg
cggaangtca cctgcagtcc tggngggaat cagagcacgc ggancagtcc ggaagaacgg
caggaatgca tcaaggganc caacnagttg tntacctccg gggaancgtg nccaangaaa
nggagcct
Database: dmel_all_transcript_r320
>CG5481-RA type=mRNA;
loc= 2L:complement (1382554..1384298,1386593..1386878,
1388514..1388677,1388773..1389019,1389097..1389192,
1392559..1392964,1393055..1393174,1393253..1394190,
1394356..1394487,1395858..1395998,1396140..1396424,
1397569..1397671,1398728..1398918,1421570..1422115);
ID=lea-RA; name=lea-RA;
db_xref='CG5481,FlyBase:FBgn0002543'; len=5400
Length = 5400
Genome Map
Score = 1037 bits (539), Expect = 0.0
Identities = 541/542 (99%)
Strand = Plus / Plus
Query: 1 agcaacaggcgcagcagccgcaccagcaacaccaggctctccagcagcaccagcaactgc 60
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3895 agcaacaggcgcagcagacgcaccagcaacaccaggctctccagcagcaccagcaactgc 3954
Query: 61 cacccagcaacatctaccagcagatgtccaccaccagcgagatataccccacgaacacgg 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3955 cacccagcaacatctaccagcagatgtccaccaccagcgagatataccccacgaacacgg 4014
Query: 121 gtccttcgcgctctgtctactctgagcagtattactaccccaaggacaagcagagacaca 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4015 gtccttcgcgctctgtctactctgagcagtattactaccccaaggacaagcagagacaca 4074
Query: 181 tccacatcaccgagaacaagctgagcaactgccacacctatgaggcggctcctggcgcca 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4075 tccacatcaccgagaacaagctgagcaactgccacacctatgaggcggctcctggcgcca 4134
Query: 241 agcagtcctcgccgatatcctcgcagttcgccagcgtgaggcggcagcagctgccgccca 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4135 agcagtcctcgccgatatcctcgcagttcgccagcgtgaggcggcagcagctgccgccca 4194
Query: 301 actgcagcatcggcagggaaagtgcccgcttcaaggtgctaaacacggatcagggcaaga 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4195 actgcagcatcggcagggaaagtgcccgcttcaaggtgctaaacacggatcagggcaaga 4254
Query: 361 accagcagaatctcctggatctcgacggctcctcgatgtgctacaacggtctggcagact 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4255 accagcagaatctcctggatctcgacggctcctcgatgtgctacaacggtctggcagact 4314
Query: 421 cgggctgcggtggatctccctccccgatggccatgctgatgtcgcacgaggacgagcacg 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4315 cgggctgcggtggatctccctccccgatggccatgctgatgtcgcacgaggacgagcacg 4374
Query: 481 cgctgtaccacacggcggatggggatctggacgacatggaacgactgtacgtcaaggtgg 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4375 cgctgtaccacacggcggatggggatctggacgacatggaacgactgtacgtcaaggtgg 4434
Query: 541 ac 542
||
Sbjct: 4435 ac 4436
\#
anon- EST:Liang-1.76  = CG31363
>anon- EST:Liang-1.76 
gacttaattc gcctttcgaa ctgaacgaac gtgccgcggc atctgcaatt ttccgtgcat
ttccacttgc attttgtgtg tttcactttg ttacgtgtgt gccagttttc catttaatcg
ttaccgatcg tccaataagc ggctacagcg gcaaaatgat ctctaacttt gattgcaccg
ataatcaggc cagcagcaag gtgctgaggc ccccgggcgg cggatcgagc gacatctttg
gatcggagat gccgcagacc cccaggaacg tgaagaatcg catggcgtcc aacatattcg
ctgccgagaa agataatgga gtgaaaaaca acggtgatgc accacgtcgc ggccagaaga
ccgtcgactc ccactctcgg ctgtttgggg agcccacccg cccgatcacc cccggcaaga
accacatgaa gagcagcatt ccctttggtc agaacacaga ggccgttgcc gcccagaagc
tgctgaccac caatggccac tacaacggca agagcggatc ggtgtcctcg gcctcgtctt
cggtgtcgtc ctccancgag aacctcaaag atgaacagtg gctcgagatc aganggcaac
cccgtcacan gcgaaggcta caaggtcgta accaacgagt attcccaagc gccaggaagt
cgtccaatng cgggaactcc ggtgatnaac aaagaaacgg cattccccca ngcgggnaat
cgtcgggnct gttgtaatga caanccggga attt
Database: dmel_all_transcript_r320
>CG31363-RD type=mRNA;
loc= 3R:complement (7416128..7417047,7418107..7418364,
7419373..7419506,7445444..7445674); ID=CG31363-RD;
name=CG31363-RD; db_xref='CG31363,FlyBase:FBgn0051363';
len=1543
Length = 1543
Genome Map
Score = 1260 bits (655), Expect = 0.0
Identities = 718/741 (96%), Gaps = 6/741 (0%)
Strand = Plus / Plus
Query: 2 acttaattcgcctttcgaactgaacgaacgtgccgcggcatctgcaattttccgtgcatt 61
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 34 acttaattcgcctttcgaactgaacgaacgtgccgcggcatctgcaattttctgtgcatt 93
Query: 62 tccacttgcattttgtgtgtttcactttgttacgtgtgtgccagttttccatttaatcgt 121
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 94 tccacttgcattttgtgtgtttcactttgttacgtgtgtgccagttttccatttaatcgt 153
Query: 122 taccgatcgtccaataagcggctacagcggcaaaatgatctctaactttgattgcaccga 181
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 154 taccgatcgtccaataagcggctacagcggcaaaatgatctctaactttgattgcaccga 213
Query: 182 taatcaggccagcagcaaggtgctgaggcccccgggcggcggatcgagcgacatctttgg 241
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 214 taatcaggccagcagcaaggtgctgaggcccccgggcggcggatcgagcgacatctttgg 273
Query: 242 atcggagatgccgcagacccccaggaacgtgaagaatcgcatggcgtccaacatattcgc 301
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 274 atcggagatgccgcagacccccaggaacgtgaagaatcgcatggcgtccaacatattcgc 333
Query: 302 tgccgagaaagataatggagtgaaaaacaacggtgatgcaccacgtcgcggccagaagac 361
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 334 tgccgagaaagataatggagtgaaaaacaacggtgatgcaccacgtcgcggccagaagac 393
Query: 362 cgtcgactcccactctcggctgtttggggagcccacccgcccgatcacccccggcaagaa 421
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 cgtcgactcccactctcggctgtttggggagcccacccgcccgatcacccccggcaagaa 453
Query: 422 ccacatgaagagcagcattccctttggtcagaacacagaggccgttgccgcccagaagct 481
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 ccacatgaagagcagcattccctttggtcagaacacagaggccgttgccgcccagaagct 513
Query: 482 gctgaccaccaatggccactacaacggcaagagcggatcggtgtcctcggcctcgtcttc 541
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 514 gctgaccaccaatggccactacaacggcaagagcggatcggtgtcctcggcctcgtcttc 573
Query: 542 ggtgtcgtcctccancgagaacctcaaagatgaacagtggctcgagatcaganggcaacc 601
|||||||||||||| |||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 574 ggtgtcgtcctccaccgagaacctc-aagatgaacagtggctcgagatcagagggcaacc 632
Query: 602 ccgtcacangcgaaggctacaaggtcgtaaccaacgagtattcccaagcgccaggaagtc 661
|||||||| |||| ||||||||||||||| ||||||||||||||| ||||||||| ||||
Sbjct: 633 ccgtcacaggcgagggctacaaggtcgtagccaacgagtattccc-agcgccagg-agtc 690
Query: 662 gtccaatngcgggaactccggtgatnaacaaagaaacggcattcccccangcgggnaatc 721
||||||| || || ||||||||||| ||||| ||| ||||||||||| |||| | ||
Sbjct: 691 gtccaatggc-ggcactccggtgatcaacaa--gaaccgcattcccccaggcggctactc 747
Query: 722 gtcgggnctgttgtaatgaca 742
|||||| |||| |||||||||
Sbjct: 748 gtcgggcctgtggtaatgaca 768
\#
anon- EST:Liang-1.79  = CG5395
>anon- EST:Liang-1.79 
ggctctaaat agaatatctg cagaaacatg gacaacttcg gactgggcgg atcggatcta
agcaaggggc agatattcca ggtactggtt cgcctgtctg tggcctcgct gatcacatat
tattcggtga aatggatgat gaaccagatg gatccgacca gtaaaaacaa gaaaaaggcc
aaagttctgg ctgaggagca gcttaagagg ctagccgagc aggagggctt caagctaaga
gggcaagagt ttagcgacta cgagcttatg attgcgtcac atcttgttgt tcccgccgac
ataacagtca gttgggccga tatcgccggt ctgggattca gtcattcatg agctccggga
atcggtggtg ctgccaatcc agcacaagga tctcttcaag cattcgaagc tgtggcaggc
gcccaaaggc gtcctgctcc atggacnanc gggctgtgga aagacgctga tancgaaggc
gacggnaaaa gaagcgggaa tgcgccttta tcaacttggg angtcgccat tcttancgac
aagtggtacg gggaatncca ngaaattgac ttctgctgtc ttctcgcttc atcncgaatt
tagcatgcan taatttttat tgacnaaaat aactcatttt tgngatttcg anacattacg
ancattaang gnnaccgccc attattaagn acccantttt atnatagcng tggggattgg
cttagcacca aat
Database: dmel_all_transcript_r320
>CG5395-RA type=mRNA;
loc= 2L:complement (10295001..10296007,
10296064..10296354); ID=nmd-RA; name=nmd-RA;
db_xref='CG5395,FlyBase:FBgn0005322'; len=1298
Length = 1298
Genome Map
Score = 1063 bits (553), Expect = 0.0
Identities = 630/657 (95%), Gaps = 7/657 (1%)
Strand = Plus / Plus
Query: 2 gctctaaatagaatatctgcagaaacatggacaacttcggactgggcggatcggatctaa 61
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 84 gctctaaatagaatatctgcagaaacatggacaacttcggactgggcggatcggatctaa 143
Query: 62 gcaaggggcagatattccaggtactggttcgcctgtctgtggcctcgctgatcacatatt 121
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 144 gcaaggggcagatattccaggtactggttcgcctgtctgtggcctcgctgatcacatatt 203
Query: 122 attcggtgaaatggatgatgaaccagatggatccgaccagtaaaaacaagaaaaaggcca 181
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 204 attcggtgaaatggatgatgaaccagatggatccgaccagtaaaaacaagaaaaaggcca 263
Query: 182 aagttctggctgaggagcagcttaagaggctagccgagcaggagggcttcaagctaagag 241
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 264 aagttctggctgaggagcagcttaagaggctagccgagcaggagggcttcaagctaagag 323
Query: 242 ggcaagagtttagcgactacgagcttatgattgcgtcacatcttgttgttcccgccgaca 301
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 324 ggcaagagtttagcgactacgagcttatgattgcgtcacatcttgttgttcccgccgaca 383
Query: 302 taacagtcagttgggccgatatcgccggtctgggattcagtcattcatgagctccgggaa 361
||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||
Sbjct: 384 taacagtcagttgggccgatatcgccggtct-ggattcagtcattcaggagctccgggaa 442
Query: 362 tcggtggtgctgccaatccagcacaaggatctcttcaagcattcgaagctgtggcaggcg 421
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 443 tcggtggtgctgccaatccagcacaaggatctcttcaagcattcgaagctgtggcaggcg 502
Query: 422 cccaaaggcgtcctgctccatggacnancgggctgtggaaagacgctgatancgaaggcg 481
||||||||||||||||||||||||| | ||||||||||||||||||||||| ||||||||
Sbjct: 503 cccaaaggcgtcctgctccatggaccaccgggctgtggaaagacgctgatagcgaaggcg 562
Query: 482 acggnaaaagaagcgggaatgcgcctttatcaacttgggangtcgccattcttancgaca 541
|||| |||||| ||||||||||| |||||||||||| ||| ||||||||||||| |||||
Sbjct: 563 acggcaaaagaggcgggaatgcg-ctttatcaactt-ggacgtcgccattcttaccgaca 620
Query: 542 agtggtacggggaatnccangaaattgacttctgctgtcttctcgctt-catcncgaatt 600
||||||||||||||| ||| |||||||||||||||||||||||||||| |||| |||||
Sbjct: 621 agtggtacggggaatccca-gaaattgacttctgctgtcttctcgcttgcatcgcgaatc 679
Query: 601 tag-catgcantaatttttattgacnaaaataactcatttttgngatttcganacat 656
|| |||||| | |||||||||||| ||| ||||||||||| ||| |||| ||||
Sbjct: 680 gagccatgcatt-atttttattgacgaaatagactcatttttgcgatctcgaaacat 735
\#
anon- EST:Liang-1.80  == CG14996
\#
anon- EST:Liang-1.83  = CG7055
>anon- EST:Liang-1.83 
acgaccctat taccagcccc agtacggcgg acatcccacg ccacagccct actacgcacc
gttctcgccg tatcagcagt cctatggccc gccacctggc tcgcactaca tgtcaccgcg
tccgccgccg ccgcagcaca atggcaatcc cgggcatccg tatgcgccgg agcatggaag
caatccaccg ccaccacagc agcagcaaca acaacaaccg ccaccaggac acctgcacga
gccgagcggt ggaggacccg gggccccagg cggtggagct ggagcggcag cagcagcggc
gcccggagcc ggagtgtatc ccacgcccgg ggcaggagcg ggaccaggag caccacctgg
accagctgga ggagcaccgc tgggcgaggc cgcagtagct gggggagtag ctccgccagc
ggcaacagca cctggcaagc atccagaggc ggagaagcac gaggcggact aagacaagga
atcccaccac ccagatctag ttgtggtccc taacttatat atgaatcgat tcctggtgtt
gtaacatagc tgtcccctcc cggaacttcc ggaaggcaaa caaccggaat gctcttaact
tgaaatccct atttaggcgc cacacctaaa gaactccaca tcaatccatt ctcaaattaa
agtttatatc actttttttt cgcnaaagcc taaattttaa tattttataa ctgagtgtgc
gtccaatcct ggactgttag ctaaat
Database: dmel_all_transcript_r320
>CG7055-RA type=mRNA; loc= X:8888309..8890962 ; ID=dalao-RA; Genome Map
name=dalao-RA; db_xref='CG7055,FlyBase:FBgn0030093';
len=2654
Length = 2654
Score = 1263 bits (657), Expect = 0.0
Identities = 727/749 (97%), Gaps = 7/749 (0%)
Strand = Plus / Plus
Query: 1 acgaccctattaccagccccagtacggcggacatcccacgccacagccctactacgcacc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1877 acgaccctattaccagccccagtacggcggacatcccacgccacagccctactacgcacc 1936
Query: 61 gttctcgccgtatcagcagtcctatggcccgccacctggctcgcactacatgtcaccgcg 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1937 gttctcgccgtatcagcagtcctatggcccgccacctggctcgcactacatgtcaccgcg 1996
Query: 121 tccgccgccgccgcagcacaatggcaatcccgggcatccgtatgcgccggagcatggaag 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1997 tccgccgccgccgcagcacaatggcaatcccgggcatccgtatgcgccggagcatggaag 2056
Query: 181 caatccaccgccaccacagcagcagcaacaacaacaaccgccaccaggacacctgcacga 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2057 caatccaccgccaccacagcagcagcaacaacaacaaccgccaccaggacacctgcacga 2116
Query: 241 gccgagcggtggaggacccggggccccaggcggtggagctggagcggcagcagcagcggc 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2117 gccgagcggtggaggacccggggccccaggcggtggagctggagcggcagcagcagcggc 2176
Query: 301 gcccggagccggagtgtatcccacgcccggggcaggagcgggaccaggagcaccacctgg 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2177 gcccggagccggagtgtatcccacgcccggggcaggagcgggaccaggagcaccacctgg 2236
Query: 361 accagctggaggagcaccgctgggcgaggccgcagtagctgggggagtagctccgccagc 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2237 accagctggaggagcaccgctgggcgaggccgcagtagctgggggagtagctccgccagc 2296
Query: 421 ggcaacagcacctggcaagcatccagaggcggagaagcacgaggcggactaagacaagga 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2297 ggcaacagcacctggcaagcatccagaggcggagaagcacgaggcggactaagacaagga 2356
Query: 481 atcccaccacccagat-ctagttgtggtccctaacttatatatgaatcgattcctggtgt 539
|||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 2357 atcccaccacccagatcctagttgtggtccctaacttatatatgaatcgatccctggtgt 2416
Query: 540 tgtaacatagctgtcccctcccggaacttccggaaggcaaacaaccggaatgctcttaac 599
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2417 tgtaacatagctgtcccctcccggaacttccggaaggcaaacaaccggaatgctcttaac 2476
Query: 600 ttgaaatccctatttaggcgccacacctaaagaactccacatcaat-ccattctcaaatt 658
|||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||
Sbjct: 2477 ttgaaatccctatttaggcgccacacct-aagaactccacatcaatcccattctcaaatt 2535
Query: 659 aaagtttatatcacnnnnnnnncgcnaaagcctaaattttaatatttt-ataactgagtg 717
||||||||||||| ||| |||||| |||||||||||||| |||||||||||
Sbjct: 2536 \-aagtttatatcacttttttttcgcg-aagcct-aattttaatattttaataactgagtg 2592
Query: 718 tgcgtccaatcctggactgttagctaaat 746
|||||| || ||||||||| |||||||
Sbjct: 2593 tgcgtcgcattctggactgtatgctaaat 2621
\#
anon- EST:Liang-2.1  no sequence data available
\#
anon- EST:Liang-2.12  = CG17841
>anon- EST:Liang-2.12 
ggcacgaatc catgagccct cgcaccgccg agtcttccag ctcctcccga tcgcccagtc
gtccaatcgc catgtcccag acgcagtgcc gcctgtaaac aaccgccgag tgaagtccgc
agcccgcagt catcggtagc agcagcgtca ggagtccgga atccgtttct cggtttccgc
aacaggttgc gtcgccttcg ccaacagaag gttttagtgc gagctttgat cagagcgtgg
agtgcgtata cgcgccagga tgcagcagcg ccgacagccg gcgaatggca acggcagagg
aggaggaacc accgccgccg tccgtacgga ggagcagcaa caacagcagc agccattgag
tcaggatgct ggcgccaagg aggcgggcag cacgccgggc aagacaacgg gacgcggctg
ctatttctcg ctggccttct ccatcggttc gatgggcctg gcctgcggca gcctgtggca
gataccgaac agcagtgacc gcatctcgct gcagcgcggc ctggtgctca cctcgctggg
attcatctat tttgtctcgc taacggactt ctgcaacaaa tacctgctgg gagacgacgc
atggacagcg ctttcgtcgc aaagtaccgc ctgatgatgt tccgacgtcc tggagataan
caaacaaaat cgtctcggga atccaaggcc tcaatctcct tcttcgtggg aactcatcgt
ctgcaaagtc gacatgcacc aaatccnttg ttg
Database: dmel_all_transcript_r320
>CG17841-RA type=mRNA;
loc= X:join (10107959..10108667,10121567..10122017,
10122089..10122418,10122490..10123139); ID=CG17841-RA;
name=CG17841-RA; db_xref='CG17841,FlyBase:FBgn0028480';
len=2140
Length = 2140
Genome Map
Score = 1304 bits (678), Expect = 0.0
Identities = 737/750 (98%), Gaps = 7/750 (0%)
Strand = Plus / Plus
Query: 2 gcacgaatccatgagccctcgcaccgccgagtcttccagctcctcccgatcgcccagtcg 61
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 48 gcacgaatccatgagccctcgcaccgccgagtcttccagctcctcccgatcgcccagtcg 107
Query: 62 tccaatcgccatgtcccagacgcagtgccgcctgtaaacaaccgccgagtgaagtccgca 121
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 108 tccaatcgccatgtcccagacgcagtgccgcctgtaaacaaccgccgagtgaagtccgca 167
Query: 122 gcccgcagtcatcggtagcagcagcgtcaggagtccggaatccgtttctcggtttccgca 181
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 168 gcccgcagtcatcggtagcagcagcgtcaggagtccggaatccgtttctcggtttccgca 227
Query: 182 acaggttgcgtcgccttcgccaacagaaggttttagtgcgagctttgatcagagcgtgga 241
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 228 acaggttgcgtcgccttcgccaacagaaggttttagtgcgagctttgatcagagcgtgga 287
Query: 242 gtgcgtatacgcgccaggatgcagcagcgccgacagccggcgaatggcaacggcagagga 301
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 288 gtgcgtatacgcgccaggatgcagcagcgccgacagccggcgaatggcaacggcagagga 347
Query: 302 ggaggaaccaccgccgccgtccgtacggaggagcagcaacaacagcagcagccattgagt 361
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 348 ggaggaaccaccgccgccgtccgtacggaggagcagcaacaacagcagcagccattgagt 407
Query: 362 caggatgctggcgccaaggaggcgggcagcacgccgggcaagacaacgggacgcggctgc 421
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 408 caggatgctggcgccaaggaggcgggcagcacgccgggcaaggcaacgggacgcggctgc 467
Query: 422 tatttctcgctggccttctccatcggttcgatgggcctggcctgcggcagcctgtggcag 481
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 468 tatttctcgctggccttctccatcggttcgatgggcctggcctgcggcagcctgtggcag 527
Query: 482 ataccgaacagcagtgaccgcatctcgctgcagcgcggcctggtgctcacctcgctggga 541
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 528 ataccgaacagcagtgaccgcatctcgctgcagcgcggcctggtgctcacctcgctggga 587
Query: 542 ttcatctattttgtctcgctaacggacttctgcaacaaatacctgctgggagacgacgca 601
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 588 ttcatctattttgtctcgctaacggacttctgcaacaaatacctgct-ggagacgacgca 646
Query: 602 tggacagcgctttcgtcgcaaagtaccgcctgatgatgttccgacgtcctggagataanc 661
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
Sbjct: 647 tggacagcgctttcgtcgc-aagtaccgcctgatgatg-tccgacgtcctggagataacc 704
Query: 662 aaacaaaatcgtctcgggaatccaaggcctcaatctccttcttcgtgggaactcatcgtc 721
|||||||||||||||| ||||| |||||||| |||||||||||||||| ||||||||||
Sbjct: 705 \-aacaaaatcgtctcggcaatcc-aggcctcattctccttcttcgtggg-actcatcgtc 761
Query: 722 tgcaaagtcgacatgcaccaaatccnttgt 751
||| |||||||| |||||||||||| ||||
Sbjct: 762 tgc-aagtcgacgtgcaccaaatcctttgt 790
\#
anon- EST:Liang-2.13  = ? on hth intron ?
>anon- EST:Liang-2.13 
gtcattatga acacacacaa aacacccaca cacacattgt aaattagtca gaatcagtaa
atgaaaacaa aaaaaaaaaa aaacatacaa aaagcgaaga aagcccaaaa caaaaaaaaa
atacccacac aaaacacaaa aatatattaa taaattcaga aatatacaga atcaagcgaa
aaggagagca gaggaatttc ctagccggag cagcagcagc aacatcaacg gcagctacat
gcaacatgcg gcagcaacat cgccggccag cagcagcagc cgaggacagt aaccgacatg
agtgactaac cagcgacaaa cgagcttcca agaggcttcg gccacaatcc gaaccgaaaa
acacaacgaa ccgactccac gaacgaccaa accgaactgc gaaccacgaa tcacgagtgt
atcttgcgga tgcggatacc cattaatgtt gctatcgctg ccacggccag aatttgtttg
ctctcctctg tgtacagtaa atgccataaa tataagttcc gaaaaagcac tgaggacagc
cgtggctagg gccgaaagtg agtacacttt tgcctgcccc angcgccttc ccagttcatc
tcaancgctc tcaaaaaaca ngaaaacacg taaaccacaa caaaacatca agtttntata
tctcaaggca gantggtaaa tggntnaagg ttanacaatt acgaaancaa aanncaactg
gggcaacaat taatt
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003687 |gb|AE003687| arm:3R  6210549..6470716
estimated- cyto:86B2-86C3  gadfly- seqname:AE003687 
 seq_release:3 
Length = 260168
Score = 929 bits (483), Expect = 0.0 Genome Map
Identities = 534/546 (97%), Gaps = 6/546 (1%)
Strand = Plus / Minus
Query: 122 tacccacacaaaacacaaaaatatattaataaattcagaaatatacagaatcaagcgaaa 181
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 200459 tacccacacaaaacacaaaaatatattaataaattcagaaatatacagaatcaagcgaaa
200400
Query: 182 aggagagcagaggaatttcctagccggagcagcagcagcaacatcaacggcagctacatg 241
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 200399 aggagagcagaggaatttcctagccggagcagcagcagcaacatcaacggcagctacatg
200340
Query: 242 caacatgcggcagcaacatcgccggccagcagcagcagccgaggacagtaaccgacatga 301
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 200339 caacatgcggcagcaacatcgccggccagcagcagcagccgaggacagtaaccgacatga
200280
Query: 302 gtgactaaccagcgacaaacgagcttccaagaggcttcggccacaatccgaaccgaaaaa 361
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 200279 gtgactaaccagcgacaaacgagcttccaagaggcttcggccacaatccgaaccgaaaaa
200220
Query: 362 cacaacgaaccgactccacgaacgaccaaaccgaactgcgaaccacgaatcacgagtgta 421
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 200219 cacaacgaaccgactccacgaacgaccaaaccgaactgcgaaccacgaatcacgagtgta
200160
Query: 422 tcttgcggatgcggatacccattaatgttgctatcgctgccacggccagaatttgtttgc 481
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 200159 tcttgcggatgcggatacccattaatgttgctatagctgccacggccagaatttgtttgc
200100
Query: 482 tctcctctgtgtacagtaaatgccataaatataagttccgaaaaagcactgaggacagcc 541
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 200099 tctcctctgtgtacagtaaatgccataaatataagttccg-aaaagcactgaggacagcc
200041
Query: 542 gtggctagggccgaaagtgagtacacttttgcctgccccangcgccttcccagttcatct 601
||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 200040 gtggctagggccg-aagtgagtacacttttgcctgccccacgcgccttcccagttcatct
199982
Query: 602 caancgctctcaaaaaacangaaaacacgtaaaccacaacaaaacatcaagtttntatat 661
|| | ||||||||||||| ||||||||||||| |||||| ||||||| ||||| |||||
Sbjct: 199981 cacgccctctcaaaaaaca-gaaaacacgtaaa-cacaac-aaacatc-agtttatatat
199926
Query: 662 ctcaag 667
||||||
Sbjct: 199925 ctcaag 199920
\#
anon- EST:Liang-2.14  = sd?
>anon- EST:Liang-2.14 
aaaatnatan ggatatcgat gntttgatag tatttnaagt ggaggaggtt atttatanan
anttataagg gaatactang ttattaatt
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003500 |gb|AE003500| arm:X  15436758..15740102
estimated- cyto:13E8-14A6  gadfly- seqname:AE003500 
 seq_release:3 
Length = 303345
Score = 79.5 bits (41), Expect = 1e-14 Genome Map
Identities = 60/73 (82%)
Strand = Plus / Plus
Query: 4 atnatanggatatcgatgntttgatagtatttnaagtggaggaggttatttatananant 63
|| ||| ||||||||||| |||| || | || ||||||||||||||||||||| | | |
Sbjct: 119088 atcatacggatatcgatgccttgacagcacttcaagtggaggaggttatttatacacagt
119147
Query: 64 tataagggaatac 76
| ||||||||||
Sbjct: 119148 cacaagggaatac 119160
Database: dmel_all_transcript_r320
>CG8544-RC type=mRNA;
loc= X:join (15549171..15549532,15550610..15550737,
15551010..15551148,15551437..15551567,15554201..15554241,
15554322..15554496,15554633..15554695,15554766..15554938,
15555056..15555290,15555349..15556750); ID=sd-RC;
name=sd-RC; db_xref='CG8544,FlyBase:FBgn0003345';
len=2849
Length = 2849
Genome Map
Score = 79.5 bits (41), Expect = 3e-15
Identities = 60/73 (82%)
Strand = Plus / Plus
Query: 4 atnatanggatatcgatgntttgatagtatttnaagtggaggaggttatttatananant 63
|| ||| ||||||||||| |||| || | || ||||||||||||||||||||| | | |
Sbjct: 1944 atcatacggatatcgatgccttgacagcacttcaagtggaggaggttatttatacacagt 2003
Query: 64 tataagggaatac 76
| ||||||||||
Sbjct: 2004 cacaagggaatac 2016
\#
anon- EST:Liang-2.15  == CG15100
\#
anon- EST:Liang-2.16  = CG4602? match bad, but note n's in query seq
>anon- EST:Liang-2.16 
tcatacnggt tctggccata cccgaggant atcgggccct gnanatgntt aataacggaa
cnantgtgcc gggantccan annccggact ccaagctacn gnccgaagtc attaancgca
tcgagggana gntgccgcat caagtgatca anacntanta ccccaagttg gtggaattca
atctgccgga gtanccggcc ttaccctcnt tctacgatgc gcgcaaaatc taggagattc
ggngcaccat tatcgtgtgn natnttaaga acnagtggcg cctaaangat ctgatggaat
gctttcancg nnctggggag gtgaagtatg cncgctgggc cgagaaggat ancaanacgt
actgcattga ttgatttctg cgaacagacc ancattattc acgctctgcg catgcagggn
caggagttca agggtggcca nctaanncgt tancaatcna cg
Database: dmel_all_transcript_r320
>CG4602-RA type=mRNA; loc= 2L:9905316..9907453 ; ID=Srp54-RA; Genome Map
name=Srp54-RA; db_xref='CG4602,FlyBase:FBgn0024285';
len=2138
Length = 2138
Score = 639 bits (332), Expect = 0.0
Identities = 397/445 (89%), Gaps = 1/445 (0%)
Strand = Plus / Plus
Query: 1 tcatacnggttctggccatacccgaggantatcgggccctgnanatgnttaataacggaa 60
|||||| |||||||||||||||||||| |||||||||||| | ||| | || |||||||
Sbjct: 389 tcatacccgttctggccatacccgaggagtatcgggccctggagatgctcaagaacggaa 448
Query: 61 cnantgtgccgggantccanannccggactccaagctacngnccgaagtcattaancgca 120
| | |||||||||| |||| | |||||||||||||||| | ||||||||||||| ||||
Sbjct: 449 ccattgtgccgggactccagaagccggactccaagctaccgcccgaagtcattaaccgca 508
Query: 121 tcgaggganagntgccgcatcaagtgatcaanacntantaccccaagttggtggaattca 180
|||||||| || ||||||| ||||||||||| || || |||||||||||||||||||||
Sbjct: 509 tcgagggacagctgccgcagcaagtgatcaagacgtacgaccccaagttggtggaattca 568
Query: 181 atctgccggagtanccggccttaccctcnttctacgatgcgcgcaaaatctaggagattc 240
||||||||||||| |||||||||||||| ||||||||||||||||||||| |||||||||
Sbjct: 569 atctgccggagtacccggccttaccctcgttctacgatgcgcgcaaaatcgaggagattc 628
Query: 241 ggngcaccattatcgtgtgnnatnttaagaacnagtggcgcctaaangatctgatggaat 300
|| |||||||||||||||| || |||||||| ||||||| ||| | |||||||||||||
Sbjct: 629 ggcgcaccattatcgtgtgcgatgttaagaacgagtggcggctagacgatctgatggaat 688
Query: 301 gctttcancgnnctggggaggtgaagtatgcncgctgggccgagaaggatancaanacgt 360
||||||| || ||||||||||||||||||| || |||||||||||||||| ||| ||||
Sbjct: 689 gctttcagcgcgctggggaggtgaagtatgcccgttgggccgagaaggataacaagacgt 748
Query: 361 actgcattgattgatttctgcgaacagaccancattattcacgctctgcgcatgcagggn 420
|||||| ||||||| |||||||||||||||| |||||||||||| ||||||||||||||
Sbjct: 749 actgca-tgattgagttctgcgaacagaccagcattattcacgccctgcgcatgcagggc 807
Query: 421 caggagttcaagggtggccanctaa 445
|||||||||||||||||||| ||||
Sbjct: 808 caggagttcaagggtggccatctaa 832
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003626 |gb|AE003626| arm:2L  9701091..9966189
estimated- cyto:30C5-30F5  gadfly- seqname:AE003626 
 seq_release:3 
Length = 265099
Score = 639 bits (332), Expect = 0.0 Genome Map
Identities = 397/445 (89%), Gaps = 1/445 (0%)
Strand = Plus / Plus
Query: 1 tcatacnggttctggccatacccgaggantatcgggccctgnanatgnttaataacggaa 60
|||||| |||||||||||||||||||| |||||||||||| | ||| | || |||||||
Sbjct: 204614 tcatacccgttctggccatacccgaggagtatcgggccctggagatgctcaagaacggaa
204673
Query: 61 cnantgtgccgggantccanannccggactccaagctacngnccgaagtcattaancgca 120
| | |||||||||| |||| | |||||||||||||||| | ||||||||||||| ||||
Sbjct: 204674 ccattgtgccgggactccagaagccggactccaagctaccgcccgaagtcattaaccgca
204733
Query: 121 tcgaggganagntgccgcatcaagtgatcaanacntantaccccaagttggtggaattca 180
|||||||| || ||||||| ||||||||||| || || |||||||||||||||||||||
Sbjct: 204734 tcgagggacagctgccgcagcaagtgatcaagacgtacgaccccaagttggtggaattca
204793
Query: 181 atctgccggagtanccggccttaccctcnttctacgatgcgcgcaaaatctaggagattc 240
||||||||||||| |||||||||||||| ||||||||||||||||||||| |||||||||
Sbjct: 204794 atctgccggagtacccggccttaccctcgttctacgatgcgcgcaaaatcgaggagattc
204853
Query: 241 ggngcaccattatcgtgtgnnatnttaagaacnagtggcgcctaaangatctgatggaat 300
|| |||||||||||||||| || |||||||| ||||||| ||| | |||||||||||||
Sbjct: 204854 ggcgcaccattatcgtgtgcgatgttaagaacgagtggcggctagacgatctgatggaat
204913
Query: 301 gctttcancgnnctggggaggtgaagtatgcncgctgggccgagaaggatancaanacgt 360
||||||| || ||||||||||||||||||| || |||||||||||||||| ||| ||||
Sbjct: 204914 gctttcagcgcgctggggaggtgaagtatgcccgttgggccgagaaggataacaagacgt
204973
Query: 361 actgcattgattgatttctgcgaacagaccancattattcacgctctgcgcatgcagggn 420
|||||| ||||||| |||||||||||||||| |||||||||||| ||||||||||||||
Sbjct: 204974 actgca-tgattgagttctgcgaacagaccagcattattcacgccctgcgcatgcagggc
205032
Query: 421 caggagttcaagggtggccanctaa 445
|||||||||||||||||||| ||||
Sbjct: 205033 caggagttcaagggtggccatctaa 205057
\#
>anon- EST:Liang-2.19  = CG32177
>anon- EST:Liang-2.19 
gatgatcagt tgggaccgcc aaaggcggac ttcagtgctc cgccaccgca cgaggcgaac
gttggccatg gccagcaggt agcactgccg gctcagatgc caccgctggc cttggccaca
cccgatccca gtcagatccc gatgcagatg caagtgcagc tgccgggcca ggcggacctt
atgaatgcac aactgccgcc agaaatacac gggaagttgc ccacgtacga ggaggttcaa
atggaaaagt cgctgaacgg agagctgccg cccgcctttt tgactttacc ctcctcgcag
cagctaccgc cgccgccgaa tccgctactg ccgccaaatc cgctgcgcga tggatccgct
gctgtgcgat ctgcccagcc ggcactcacg ttcatcgcca tcgatgccag cgatccggaa
aatagtctgt ccaccaccga caacttgctc ggcacggaca tcatgttcat cacggccttc
attgtggccc ttttgtttaa ctggatcggc ttcctgatgc tcacctgttt ctgtcacaca
atcgccgccc gatatggagc attgtcggga ttcggattgt cnctgggtaa atggacgctg
atngtgaagc actcgacggg ncttggcctc gcacgaaaaa ctcctggctc tggtggctga
tctgtgcctt tggcttcctg ataagcatac gcgcnttann cagtatgtca gcattaaagc
nnatcgttgg
Database: dmel_all_transcript_r320
>CG32177-RA type=mRNA;
loc= 3L:complement (17596318..17598125,17602871..17603155); Genome
Map
ID=CG32177-RA; name=CG32177-RA;
db_xref='CG32177,FlyBase:FBgn0052177'; len=2093
Length = 2093
Score = 1265 bits (658), Expect = 0.0
Identities = 699/715 (97%), Gaps = 3/715 (0%)
Strand = Plus / Plus
Query: 1 gatgatcagttgggaccgccaaaggcggacttcagtgctccgccaccgcacgaggcgaac 60
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 318 gatgatcagttgggaccgccaaaggcggacttcagtgctccgccaccgtacgaggcgaac 377
Query: 61 gttggccatggccagcaggtagcactgccggctcagatgccaccgctggccttggccaca 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 378 gttggccatggccagcaggtagcactgccggctcagatgccaccgctggccttggccaca 437
Query: 121 cccgatcccagtcagatcccgatgcagatgcaagtgcagctgccgggccaggcggacctt 180
||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||
Sbjct: 438 cccgatcccagtcagatcccgatacagatgcaagtgcagctgccgagccaggcggacctt 497
Query: 181 atgaatgcacaactgccgccagaaatacacgggaagttgcccacgtacgaggaggttcaa 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 498 atgaatgcacaactgccgccagaaatacacgggaagttgcccacgtacgaggaggttcaa 557
Query: 241 atggaaaagtcgctgaacggagagctgccgcccgcctttttgactttaccctcctcgcag 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 558 atggaaaagtcgctgaacggagagctgccgcccgcctttttgactttaccctcctcgcag 617
Query: 301 cagctaccgccgccgccgaatccgctactgccgccaaatccgctgcgcgatggatccgct 360
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 618 cagctaccgccgccgccgaatccgctactgccgccaaatccgctgcgcgatggagccgct 677
Query: 361 gctgtgcgatctgcccagccggcactcacgttcatcgccatcgatgccagcgatccggaa 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 678 gctgtgcgatctgcccagccggcactcacgttcatcgccatcgatgccagcgatccggaa 737
Query: 421 aatagtctgtccaccaccgacaacttgctcggcacggacatcatgttcatcacggccttc 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 738 aatagtctgtccaccaccgacaacttgctcggcacggacatcatgttcatcacggccttc 797
Query: 481 attgtggcccttttgtttaactggatcggcttcctgatgctcacctgtttctgtcacaca 540
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 798 attgtggcctttttgtttaactggatcggcttcctgatgctcacctgtttctgtcacaca 857
Query: 541 atcgccgcccgatatggagcattgtcgggattcggattgtcnctgggtaaatggacgctg 600
||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||
Sbjct: 858 atcgccgcccgatatggagcattgtcgggattcggattgtcgctggctaaatggacgctg 917
Query: 601 atngtgaagcactcgacgggncttggcctcgcacgaaaaactcctggctctggtggctga 660
|| |||||||||||||| || |||||||||||||| ||||||||||||||||||||||||
Sbjct: 918 atcgtgaagcactcgac-ggacttggcctcgcacg-aaaactcctggctctggtggctga 975
Query: 661 tctgtgcctttggcttcctgataagcatacgcgcntt-anncagtatgtcagcat 714
|||||||||||||||||||||| ||||||||||| || | ||||||||||||||
Sbjct: 976 tctgtgcctttggcttcctgatcagcatacgcgctttaatacagtatgtcagcat 1030
\#
anon- EST:Liang-2.2  = CG15154
>anon- EST:Liang-2.2 
gagtcagcaa tatgttgtcg gcgggaacgc aacacagcag caagccagtt tccagaagca
ataatagcaa cagttgctgc cgcagtcgca gcagtaaagc actttcaatg ggagcagcaa
catcctccgc ctccggatcc gcatccacat ccgtgtccac atccacatcc tcgaagcgac
gatgctgcaa gtgcaagtgc cgcgacgcca tccgaggatt aagggatatg ctgccgagca
gcagcagttc cgtgagcaat aaaaaggatg ccgctgcggt ggtggcgatg gttccgagga
aatcccggac agctgaccgc cgctccacac cgcccacgct gggcacatcg agtggtggct
cacagcgccg gatgcagagc caaaggatac gaaattccgt cgccgttccg gacgccagtc
atcaccatca tcaagctcat cattcggatc acatcgccgg gcttcgtggt cgagtcgccc
aatggcggcc gcgtaactgt ggtcaccgag cccgcccccc agtcgcccag actccgcccc
ggccacgtcc cctggccacg gtcgcccccg tcggaggggc tggccatgcc ggaatcggag
ccgcccgcaa catgaccgnt gcactcgcaa aatcgacttc atgcactgcc tggttnccga
tttcgagaag attaacgaan agcaagcttc taacgggggg caanatggcc cgcttaccaa
ggnggggcaa cntggt
Database: dmel_all_transcript_r320
>CG15154-RB type=mRNA;
loc= 2L:complement (18116751..18117927,18117979..18118237,
18118526..18119333,18119827..18120663,
18130123..18130493); ID=Socs36E-RB; name=Socs36E-RB;
db_xref='CG15154,FlyBase:FBgn0041184'; len=3452
Length = 3452
Genome Map
Score = 1210 bits (629), Expect = 0.0
Identities = 664/672 (98%), Gaps = 4/672 (0%)
Strand = Plus / Plus
Query: 2 agtcagcaatatgttgtcggcgggaacgcaacacagcagcaagccagtttccagaagcaa 61
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1162 agtcagcaatatgttgtcggcgggaacgcaacacagcagcaagccagtttccagaagcaa 1221
Query: 62 taatagcaacagttgctgccgcagtcgcagcagtaaagcactttcaatgggagcagcaac 121
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1222 taatagcaacagttgctgccgcagtcgcagcagtaaagcactttcaatgggagcagcaac 1281
Query: 122 atcctccgcctccggatccgcatccacatccgtgtccacatccacatcctcgaagcgacg 181
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1282 atcctccgcctccggatccgcatccacatccgtgtccacatccacatcctcgaagcgacg 1341
Query: 182 atgctgcaagtgcaagtgccgcgacgccatccgaggattaagggatatgctgccgagcag 241
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1342 atgctgcaagtgcaagtgccgcgacgccatccgaggattaagggatatgctgccgagcag 1401
Query: 242 cagcagttccgtgagcaataaaaaggatgccgctgcggtggtggcgatggttccgaggaa 301
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1402 cagcagttccgtgagcaataaaaaggatgccgctgcggtggtggcgatggttccgaggaa 1461
Query: 302 atcccggacagctgaccgccgctccacaccgcccacgctgggcacatcgagtggtggctc 361
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1462 atcccggacagctgaccgccgctccacaccgcccacgctgggcacatcgagtggtggctc 1521
Query: 362 acagcgccggatgcagagccaaaggatacgaaattccgtcgccgttccggacgccagtca 421
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 1522 acagcgccggatgcagagccaaaggatacgaaattccgtcgccgttccggacgccagcca 1581
Query: 422 tcaccatcatcaagctcatcattcggatcacatcgccgggcttcgtggtcgagtcgccca 481
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1582 tcaccatcatc-agctcatcattcggatcacatcgccgggcttcgtggtcgagtcgccca 1640
Query: 482 atggcggccgcgtaactgtggtcaccgagcccgccccccagtcg-cccagactccgcccc 540
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 1641 atggcggccgcgtaactgtggtcaccgagcccgccccccagtcgccccagactccgcccc 1700
Query: 541 ggccacgtcccctggccacggtcgcccccgtcggaggggctggccatgccggaatcggag 600
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 1701 ggccacgtcccctggccacggtcgcccccgccggaggggctggccatgccggaatcggag 1760
Query: 601 ccgcccgcaacatgaccgntgcactcgcaaaatcgacttcatgcactgcctggttnccga 660
|||||||||||||||||| ||||||||| |||||||||||||||||||||||||| ||||
Sbjct: 1761 ccgcccgcaacatgaccg-tgcactcgc-aaatcgacttcatgcactgcctggttcccga 1818
Query: 661 tttcgagaagat 672
| ||||||||||
Sbjct: 1819 tctcgagaagat 1830
\#
anon- EST:Liang-2.23  = roo element
>anon- EST:Liang-2.23 
tgnaattaat ccaaaaacta aaaggatcaa ttgacaatat aatggagatc tatgcttgga
gtgattccac gattacctta gcatggatta acagtggtca aagtaagatc aaatttataa
aaagaagaac ggatgacatt cggaaattaa aaaatactga atggaatcat gttaagtcag
aggataatcc agcagattta gcatccaggg gagtggattc taaccagttg atcaactgtg
atttttggtg gaaaggtccg aaatggctag cagacccaaa agaactttgg cctcggcagc
agtctgtaga agaacctgtc ttaataaata cggtattaaa tgacaaaata gatgatccta
tttacgaatt aatagaaagg tattccagta tagaaaaact tatacgtata atagcataca
taaatagatt cgtgcagatg aaaacaagaa ataaagccta ttcatcaatt atttcagtaa
aggagataag aatagcggaa acagttgtta ttaagaaaca acaagaatac cagtttaggc
aagagataaa gtgccttaaa atcaaaaagg aaatcaagac aaatataaaa tattgtcatt
gaatccattt ttggacaagg gatggggttc taaganttgg aggaagattg caaaattcca
atgcagaatt taatggttaa acatccaatn cattttagaa aaaatgccan ctaacaagct
tantaaataa aaaatgcnca t
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003418 |gb|AE003418| arm:X  288957..603388
estimated- cyto:1B9-1D1  gadfly- seqname:AE003418 
 seq_release:3 
Length = 314432
Score = 1308 bits (680), Expect = 0.0 Genome Map
Identities = 728/739 (98%), Gaps = 6/739 (0%)
Strand = Plus / Plus
Query: 4 aattaatccaaaaactaaaaggatcaattgacaatataatggagatctatgcttggagtg 63
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 300791 aattaatccaaagactaaaaggatcaattgacaatataatggagatctatgcttggagtg
300850
Query: 64 attccacgattaccttagcatggattaacagtggtcaaagtaagatcaaatttataaaaa 123
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 300851 attccacgattaccttagcatggattaacagtggtcaaagtaagatcaaatttataaaaa
300910
Query: 124 gaagaacggatgacattcggaaattaaaaaatactgaatggaatcatgttaagtcagagg 183
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 300911 gaagaacggatgacattcggaaattaaaaaatactgaatggaatcatgttaagtcagagg
300970
Query: 184 ataatccagcagatttagcatccaggggagtggattctaaccagttgatcaactgtgatt 243
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 300971 ataatccagcagatttagcatccaggggagtggattctaaccagttgatcaactgtgatt
301030
Query: 244 tttggtggaaaggtccgaaatggctagcagacccaaaagaactttggcctcggcagcagt 303
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301031 tttggtggaaaggtccgaaatggctagcagacccaaaagaactttggcctcggcagcagt
301090
Query: 304 ctgtagaagaacctgtcttaataaatacggtattaaatgacaaaatagatgatcctattt 363
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301091 ctgtagaagaacctgtcttaataaatacggtattaaatgacaaaatagatgatcctattt
301150
Query: 364 acgaattaatagaaaggtattccagtatagaaaaacttatacgtataatagcatacataa 423
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301151 acgaattaatagaaaggtattccagtatagaaaaacttatacgtataatagcatacataa
301210
Query: 424 atagattcgtgcagatgaaaacaagaaataaagcctattcatcaattatttcagtaaagg 483
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301211 atagattcgtgcagatgaaaacaagaaataaagcctattcatcaattatttcagtaaagg
301270
Query: 484 agataagaatagcggaaacagttgttattaagaaacaacaagaataccagtttaggcaag 543
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301271 agataagaatagcggaaacagttgttattaagaaacaacaagaataccagtttaggcaag
301330
Query: 544 agataaagtgccttaaaatcaaaaaggaaatcaagacaaat-ataaaatattgtcattga 602
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 301331 agataaagtgccttaaaatcaaaaaggaaatcaagacaaataataaaatattgtcattga
301390
Query: 603 atccatttttggacaagggatggggttctaaganttggaggaagattgcaaaattccaat 662
|||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 301391 atccatttttggacaa-ggatggggttctaagagttggaggaagattgcaaaattccaat
301449
Query: 663 gcagaatttaatggttaaacatccaatncattttagaaaaaatgccanctaacaagctta 722
|||||||||||| |||||||||||||| |||||||| |||||||||| ||||||||||||
Sbjct: 301450 gcagaatttaat-gttaaacatccaat-cattttag-aaaaatgccacctaacaagctta
301506
Query: 723 ntaaataaaaaatgcncat 741
| |||||||||||| |||
Sbjct: 301507 tt-aataaaaaatgctcat 301524
Database: dmel_all_transposon_r320
Score E
Sequences producing significant alignments: (bits) Value
FBti0019658 type=transposable_element; loc= X:20509196..20516740 ;... 1308 0.0
FBti0019083 type=transposable_element; loc= X:complement (18688083... 1308 0.0
FBti0019068 type=transposable_element; loc= X:complement (16071742... 1308 0.0
FBti0019060 type=transposable_element; loc= X:14667929..14677127 ;... 1308 0.0
FBti0019051 type=transposable_element; loc= X:13835738..13844829 ;... 1308 0.0
FBti0019630 type=transposable_element; loc= X:11474279..11481367 ;... 1308 0.0
FBti0019597 type=transposable_element; loc= X:6865677..6874777 ; I... 1308 0.0
FBti0019576 type=transposable_element; loc= X:4731680..4736379 ; I... 1308 0.0
FBti0019561 type=transposable_element; loc= X:complement (3365404.... 1308 0.0
FBti0019556 type=transposable_element; loc= X:complement (3251584.... 1308 0.0
FBti0019553 type=transposable_element; loc= X:complement (2976997.... 1308 0.0
FBti0019547 type=transposable_element; loc= X:complement (2580615.... 1308 0.0
FBti0019544 type=transposable_element; loc= X:2156665..2164959 ; I... 1308 0.0
FBti0019532 type=transposable_element; loc= X:821248..829985 ; ID=... 1308 0.0
FBti0019526 type=transposable_element; loc= X:585093..592827 ; ID=... 1308 0.0
FBti0020394 type=transposable_element; loc= 3R:complement (2770289... 1308 0.0
FBti0019450 type=transposable_element; loc= 3R:24573429..24578987 ... 1308 0.0
FBti0019439 type=transposable_element; loc= 3R:22822547..22831625 ... 1308 0.0
FBti0019435 type=transposable_element; loc= 3R:complement (2219146... 1308 0.0
FBti0019432 type=transposable_element; loc= 3R:21647833..21656956 ... 1308 0.0
FBti0019431 type=transposable_element; loc= 3R:complement (2154097... 1308 0.0
FBti0019421 type=transposable_element; loc= 3R:19651837..19660930 ... 1308 0.0
FBti0019416 type=transposable_element; loc= 3R:complement (1805623... 1308 0.0
FBti0019406 type=transposable_element; loc= 3R:complement (1598248... 1308 0.0
FBti0019374 type=transposable_element; loc= 3R:10020224..10029315 ... 1308 0.0
FBti0019357 type=transposable_element; loc= 3R:complement (7205031... 1308 0.0
FBti0020187 type=transposable_element; loc= 3L:21223479..21232579 ... 1308 0.0
etc ect
\#
anon- EST:Liang-2.24  == CG11525
\#
anon- EST:Liang-2.28  = CG2210
>anon- EST:Liang-2.28 
gattcttttc tgtaatctcg gcgacaatgg cggctaacaa ggagaggact ttcatcatgg
tcaagcccga tggcgtccag cgcgggctcg tcggcaagat catcgagcgc ttcgagcaga
agggcttcaa gctggtcgcc ctgaagttca cctgggcctc caaggagctg ctggagaagc
actacgctga tctgtccgcc cgccccttct tccccggact cgtgaactac atgaactccg
gccccgtggt gcccatggtg tgggagggtc tgaatgtggt caagaccggt cgccagatgc
tcggcgccac caaccccgcc gactcgctgc ccggcaccat ccgcggtgac ttctgcattc
aggtcggacg caacatcatc cacggctccg atgccgtcga gtctgccgan aaggagatcg
ccctgtggtt caacgaaaan gagctggtca cctggacccc ggccgccaag gactggatct
acgaatagac ggctacttta actgtctgcc ctcgtctaag ctgaatacag attgattctt
ctaaagaaat aaaattccac aataattact aanaaannnn aaanaaacan ntgctgcggc
cgccgaaant ccggtcccct aaaagtnagt cgtattaant tcgataagcc angcttgcat
taaatgaant cgggccaacn cccgggggaa aagcgggttt gcgtattggg gcgctcnncc
nctttcctcc gctcaatgan ctcgctggcg cncgggtt
Database: dmel_all_
>CG2210-RA type=mRNA;
loc= 3R:complement (27560260..27560678,
27560858..27561121); ID=awd-RA; name=awd-RA;
db_xref='CG2210,FlyBase:FBgn0000150'; len=683
Length = 683
Genome Map
Score = 1088 bits (566), Expect = 0.0
Identities = 568/570 (99%)
Strand = Plus / Plus
Query: 2 attcttttctgtaatctcggcgacaatggcggctaacaaggagaggactttcatcatggt 61
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 111 attcttttctgtaatctcggcgacaatggcggctaacaaggagaggactttcatcatggt 170
Query: 62 caagcccgatggcgtccagcgcgggctcgtcggcaagatcatcgagcgcttcgagcagaa 121
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 171 caagcccgatggcgtccagcgcgggctcgtcggcaagatcatcgagcgcttcgagcagaa 230
Query: 122 gggcttcaagctggtcgccctgaagttcacctgggcctccaaggagctgctggagaagca 181
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 231 gggcttcaagctggtcgccctgaagttcacctgggcctccaaggagctgctggagaagca 290
Query: 182 ctacgctgatctgtccgcccgccccttcttccccggactcgtgaactacatgaactccgg 241
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 291 ctacgctgatctgtccgcccgccccttcttccccggactcgtgaactacatgaactccgg 350
Query: 242 ccccgtggtgcccatggtgtgggagggtctgaatgtggtcaagaccggtcgccagatgct 301
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 351 ccccgtggtgcccatggtgtgggagggtctgaatgtggtcaagaccggtcgccagatgct 410
Query: 302 cggcgccaccaaccccgccgactcgctgcccggcaccatccgcggtgacttctgcattca 361
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 411 cggcgccaccaaccccgccgactcgctgcccggcaccatccgcggtgacttctgcattca 470
Query: 362 ggtcggacgcaacatcatccacggctccgatgccgtcgagtctgccganaaggagatcgc 421
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 471 ggtcggacgcaacatcatccacggctccgatgccgtcgagtctgccgagaaggagatcgc 530
Query: 422 cctgtggttcaacgaaaangagctggtcacctggaccccggccgccaaggactggatcta 481
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 531 cctgtggttcaacgaaaaggagctggtcacctggaccccggccgccaaggactggatcta 590
Query: 482 cgaatagacggctactttaactgtctgccctcgtctaagctgaatacagattgattcttc 541
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 591 cgaatagacggctactttaactgtctgccctcgtctaagctgaatacagattgattcttc 650
Query: 542 taaagaaataaaattccacaataattacta 571
||||||||||||||||||||||||||||||
Sbjct: 651 taaagaaataaaattccacaataattacta 680
\#
anon- EST:Liang-2.31  = not in genome
>anon- EST:Liang-2.31 
aannncntta agctgtagtg agcnagtaaa atgtnagnan ttggagnact tnagtgnaat
aatcgtnatt cctgtnanaa gg
Database: na_all.dros
Only self hit
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 2,262,611
sequences; 10,883,439,008 total letters
If you have any problems or questions with the results of this search
please refer to the BLAST FAQs
No significant similarity found. For reasons why, click here.
\#
anon- EST:Liang-2.39  = in how intron ?
>anon- EST:Liang-2.39 
acttattttg cagccaaatc taaaaatcag atcaaatcta tcgaatacac aagcgcatat
ataaacgact cattccaaag aagcagagaa tttaaatgtt acaaagtgaa atagaataca
gaatacgana aacaggtcga taattccccc tcagttggna atttggcttc naagctgctg
ccttcagctt cagtttgang caagcgaatg gtagataagt aaggangtat gcaatatcta
ttagacctaa gttgtaacct gtatctgang atgttcacat cnatttannc atatnaccga
natgtanacc tatgnaancc antatctaca tgtntcntat cgtaatnntt tagtatngcg
ccantaagca gcagcntcgt ttggcgacta nccgcgagca nccctatcag ncgancaacn
gtcgggntgc caagccanng cccggcgggt ttcaattgag antacagtng atncnatgnn
tngcttgaat tgganganaa ttcngncgca ntagtaantc agnacnttnn ccactcntan
gancacacca ctntttggca aaaag
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003737 |gb|AE003737| arm:3R  17772253..17950503
estimated- cyto:93F10-94A2  gadfly- seqname:AE003737 
 seq_release:3 
Length = 178251
Score = 631 bits (328), Expect = e-180 Genome Map
Identities = 397/432 (91%), Gaps = 5/432 (1%)
Strand = Plus / Plus
Query: 1 acttattttgcagccaaatctaaaaatcagatcaaatctatcgaatacacaagcgcatat 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 118533 acttattttgcagccaaatctaaaaatcagatcaaatctatcgaatacacaagcgcatat
118592
Query: 61 ataaacgactcattccaaagaagcagagaatttaaatgttacaaagtgaaatagaataca 120
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 118593 ataaacgactcattccaaagaagcagagaatttaaatgttacaaagtgaaagagaataca
118652
Query: 121 gaatacganaaacaggtcgataattccccctcagttggnaatttggcttcnaagctgctg 180
|||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||
Sbjct: 118653 gaatacgaaaaacaggtcgataattccccctcagttggcaatttggcttcc-agctgctg
118711
Query: 181 ccttcagcttcagtttgangcaagcgaatggtagataagtaaggangtatgcaatatcta 240
|||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 118712 ccttcagcttcagtttga-gcaagcgaatggtagataagtaaggatgtatgcaatatcta
118770
Query: 241 ttagacctaagttgtaacctgtatctgangatgttcacatcnatttanncatatnaccga 300
|||||||||||||||| |||||| |||| |||||||||||| ||||| ||||| |||||
Sbjct: 118771 ttagacctaagttgtaccctgtagctgatgatgttcacatctatttatacatataaccga
118830
Query: 301 natgtanacctatgnaanccantatctacatgtntcntatcgtaatnntttagtatngcg 360
||||| ||||||| || ||| ||||||||||| || |||||| || ||||||| |||
Sbjct: 118831 tatgtaaacctatgcaaaccaatatctacatgtatcgtatcgt-atattttagta-ggcg
118888
Query: 361 ccantaagcagcagcntcgtttggcgactanccgcgagcanccctatcagncgancaacn 420
||| ||||||||||| |||||||||||||| ||||||||| ||||||||| ||| ||||
Sbjct: 118889 ccattaagcagcagcgtcgtttggcgactaaccgcgagcatccctatcag-cgagcaacg
118947
Query: 421 gtcgggntgcca 432
||||| |||||
Sbjct: 118948 gtcggagtgcca 118959
\#
anon- EST:Liang-2.40  = no sequence data available
\#
anon- EST:Liang-2.41  = CG32662
>anon- EST:Liang-2.41 
tgaaagctaa aagagaaaga gagggctgaa aagcttaaag acctagaaaa agaantaaag
ctaaaggaaa aggaggaaca gctcaaggag aaggaaaagg agcttaaact caaggagaag
aaggagaaag acaaggtcaa agagaaggag aagtccctgg aaagcgaaaa gctcctcatc
tcggcaaccg ttagcaatcc atggaggcga gtcgtcnagg atactccacc caaactgcct
gcggttcagg actatcccan ccttggcaag aagcccacta aagcgagtcc ggagaagaag
cgggatgaaa aactgctgcc tggactgact actcccccca aagaggtgaa cgacaccttt
gaggacttct tgagcggctt aaagccactg gaggccttgc nanctctccc tgctctcgaa
cccctggagg ttaangagga ctcnaaaaag gaatctgtca gtctaatcaa ctttgaaagt
ccgttgcang agacaagctt cnataccgcg gaagatttcc caccgccacg tggtttcacc
gaaacagaat ttgnttcctc gcccttgttg cggttccctt gcactatgaa anatnaacag
ggaacgcatc cgggggaaan gganggccga aattgcancc ctganggtgg gtaanaaaca
ccgggaaacc ggttanacan ttaccctngg ananncnggg nnccngnann naatcaactc
cnaaatcgaa ananctccnc cgggatttga gggaaatttt tcgtncatnt g
Database: dmel_all_transcript_r320
>CG32662-RA type=mRNA; loc= X:11560075..11564160 ; ID=CG32662-RA; Genome Map
name=CG32662-RA; db_xref='CG32662,FlyBase:FBgn0052662';
len=4086
Length = 4086
Score = 760 bits (395), Expect = 0.0
Identities = 468/487 (96%), Gaps = 9/487 (1%)
Strand = Plus / Plus
Query: 129 agacaaggtcaaagagaaggagaagtccctggaaagcgaaaagctcctcatctcggcaac 188
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2205 agacaaggtcaaagagaaggagaagtccctggaaagcgaaaagctcctcatctcggcaac 2264
Query: 189 cgttagcaatccatggaggcgagtcgtcnaggatactccacccaaactgcctgcggttca 248
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2265 cgttagcaatccatggaggcgagtcgtcgaggatactccacccaaactgcctgcggttca 2324
Query: 249 ggactatcccanccttggcaagaagcccactaaagcgagtccggagaagaagcgggatga 308
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2325 ggactatcccagccttggcaagaagcccactaaagcgagtccggagaagaagcgggatga 2384
Query: 309 aaaactgctgcctggactgactactccccccaaagaggtgaacgacacctttgaggactt 368
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2385 aaaactgctgcctggactgactactccccccaaagaggtgaacgacacctttgaggactt 2444
Query: 369 cttgagcggcttaaagccactggaggccttgcnanctctccctgctctcgaacccctgga 428
|||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||
Sbjct: 2445 cttgagcggcttaaagccactggaggccttgccacctctccctgctctcgaacccctgga 2504
Query: 429 ggttaangaggactcnaaaaaggaatctgtcagtctaatcaactttgaaagtccgttgca 488
|||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2505 ggttaaggaggactcgaaaaaggaatctgtcagtctaatcaactttgaaagtccgttgca 2564
Query: 489 ngagacaagcttcnataccgcggaagattt-cccaccgccacgtggtttcaccgaaacag 547
||||| |||||| |||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 2565 ggagac-agcttccataccgcggaagatttccccaccgccacgtggtttcaccg-aacag 2622
Query: 548 aatttgnttcctcgcccttgttgcggttcccttgcactatgaaanatnaacagggaacgc 607
|||||| |||||| ||||| |||||||||| |||||||||||| || |||| |||||||
Sbjct: 2623 aatttga-tcctcg-ccttg-tgcggttccc-tgcactatgaaa-atgaaca-ggaacgc 2676
Query: 608 atccggg 614
|||||||
Sbjct: 2677 atccggg 2683
\#
anon- EST:Liang-2.42  = CG5014
>anon- EST:Liang-2.42 
taagaaaaaa agagagacga gtaaagtaaa acgaaacagg cataaaaaca gcagcagttt
tcttgatata tttggctaaa aaacgcaaac caaacagcca gcaagaacaa caaatagctg
ggcaaaaaca ggacgcacaa aaaataaaat taaaacgata agaggcgaaa agcggagaga
gtgaaattct cggcagcaac aacgacaaga acaacaccag gagcagcagc aacaacaaca
acaacaaaag ccagccgcca caatgagcaa atcactcttt gatcttccgt tgaccattga
accagaacat gagttgcgtt ttgtgggtcc cttcacccga cccgttgtca caatcatgac
tctgcgcaac aactcggctc tgcctctggt cttcaagatc aagacaaccg ccccgaaacg
ctactgcgta cgtccaaaca tcggcaagat aattcccttt cgatcaaccc aggtggagat
ctgccttcag ccattcgtct acgattnagc aggagaagaa caagcacaag ttcatggtgc
agagcgtcct ggcacccaat ggatgctgat ctaagcgatt taaataaatt gtggaaagga
tctgganccc gnagcagctg gatgggacgn caaactgaaa gtgcgttttc nagatgnccc
acngctgaag gcaaatgctg agaacaccaa cgggttggtg gtgccgttgg cggggggaac
cgggagcaan gcngaaacct ctccat
Database: dmel_all_transcript_r320
>CG5014-33-1-RC type=mRNA;
loc= X:join (3690044..3690329,3692031..3692183,
3692252..3692361,3692445..3692657,3692724..3692837,
3693383..3694721); ID=Vap-33-1-RC; name=Vap-33-1-RC;
db_xref='CG5014,FlyBase:FBgn0029687'; len=2215
Length = 2215
Genome Map
Score = 712 bits (370), Expect = 0.0
Identities = 449/466 (96%), Gaps = 11/466 (2%)
Strand = Plus / Plus
Query: 248 aagccagccgccacaatgagcaaatcactctttgatcttccgttgaccattgaaccagaa 307
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 208 aagccagccgccacaatgagcaaatcactctttgatcttccgttgaccattgaaccagaa 267
Query: 308 catgagttgcgttttgtgggtcccttcacccgacccgttgtcacaatcatgactctgcgc 367
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 268 catgagttgcgttttgtgggtcccttcacccgacccgttgtcacaatcatgactctgcgc 327
Query: 368 aacaactcggctctgcctctggtcttcaagatcaagacaaccgccccgaaacgctactgc 427
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 328 aacaactcggctctgcctctggtcttcaagatcaagacaaccgccccgaaacgctactgc 387
Query: 428 gtacgtccaaacatcggcaagataattccctttcgatcaacccaggtggagatctgcctt 487
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 388 gtacgtccaaacatcggcaagataattccctttcgatcaacccaggtggagatctgcctt 447
Query: 488 cagccattcgtctacgattnagcaggagaagaacaagcacaagttcatggtgcagagcgt 547
||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||
Sbjct: 448 cagccattcgtctacga-tcagcaggagaagaacaagcacaagttcatggtgcagagcgt 506
Query: 548 cctggcacccaatggatgctgatctaagcgatttaaataaattgtggaaaggatctggan 607
|||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 507 cctggcaccc-atggatgctgatctaagcgatttaaataaattgtgg-aaggatctggag 564
Query: 608 cccgnagcagctggatgggacgncaaactgaaagtgcgttttcnagatgncccacngctg 667
|||| ||||||| ||| ||||| ||||||| |||||||||||| ||||| ||||| ||||
Sbjct: 565 cccg-agcagct-gat-ggacgccaaactg-aagtgcgttttcgagatg-cccaccgctg 619
Query: 668 aaggcaaatgctgagaacaccaacgggttggtggtgccgttggcgg 713
||||||||||||||||||||| ||| ||||||||||||||||||
Sbjct: 620 \-aggcaaatgctgagaacaccagcgg--tggtggtgccgttggcgg 662
\#
anon- EST:Liang-2.47  = CG1499
>anon- EST:Liang-2.47 
gagttattcg gtcaactctc gacggtcaag ctcgcagcga tctcgcgact tggcaaccaa
aaaataattc acaaaagcac cgaatcgcgt tacaaggaac tttagtccgc ggctttgtcg
aggagcaacc tgccagcaaa gtcaagtgca acattcaata cccaccgatg tgcaatgtgt
gtaatcagca aacagtgatc atttacatac atgaataaaa ctcatctcga aagtgaagcg
tgactcagca tcgatagccg aaaaaggcag gagaacaaga caatccgaaa ggaaaggata
cttttcggtc acttccaaaa ctcacgaccc caagttacag ttgcagttgc aaaatattct
ggccaaatac aacgacgaca agacccgatc tgaagtttta gaggattgaa gacacgagag
caaacagtta agacaaaatg tttctacgcc gctgcactct actgntgctg atntgcctaa
ttgcgaatga cgccgccagc gccgcacgca aaacaaaagc gtcccgtcaa agccggtcaa
acagancaat ccgcgcaaca atgtaacgcc ttcgccgccg ntgtcgcctc atcnggggta
gttccacaac ccgccagaac cagnaagcac caccaacnac nggagggaan cnggngaacc
aagaanggtg ggcanaatcc ggattttgca gccctanccg gggggcgggg aaaatgcccn
aannctccgg ggnaagncca atcgnagggg ncaacccggg ggggaaa
Database: dmel_all_transcript_r320
>CG1499-RA type=mRNA;
loc= 3R:join (27358120..27358615,27364375..27364440,
27373215..27373596,27374317..27374477,
27375090..27375291,27375622..27375873,
27375940..27376883,27377035..27377238,
27377318..27377401,27380199..27381255); ID=CG1499-RA;
name=CG1499-RA; db_xref='CG1499,FlyBase:FBgn0039852';
len=3848
Length = 3848
Genome Map
Score = 1063 bits (553), Expect = 0.0
Identities = 616/635 (97%), Gaps = 7/635 (1%)
Strand = Plus / Plus
Query: 2 agttattcggtcaactctcgacggtcaagctcgcagcgatctcgcgacttggcaaccaaa 61
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 132 agttattcggtcaactctcgacggtcaagctcgcagcgatctcgcgacttggcaaccaaa 191
Query: 62 aaataattcacaaaagcaccgaatcgcgttacaaggaactttagtccgcggctttgtcga 121
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 192 aaataattcacaaaagcaccgaatcgcgttacaaggaactttagtccgcggctttgacga 251
Query: 122 ggagcaacctgccagcaaagtcaagtgcaacattcaatacccaccgatgtgcaatgtgtg 181
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 252 ggagcaacctaccagcaaagtcaagtgcaacattcaatacccaccgatgtgcaatgtgtg 311
Query: 182 taatcagcaaacagtgatcatttacatacatgaataaaactcatctcgaaagtgaagcgt 241
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 312 taatcagcaaacagtgatcatttacatacatgaataaaactcatctcgaaagtgaagcgt 371
Query: 242 gactcagcatcgatagccgaaaaaggcaggagaacaagacaatccgaaaggaaaggatac 301
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 372 gactcagcatcgatagccgaaaaaggcaggagaacaagacaatccgaaaggaaaggatac 431
Query: 302 ttttcggtcacttccaaaactcacgaccccaagttacagttgcagttgcaaaatattctg 361
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 432 ttttcggtcacttccagaactcacgaccccaagttacagttgcagttgcaaaatattctg 491
Query: 362 gccaaatacaacgacgacaagacccgatctgaagttttagaggattgaagacacgagagc 421
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 492 gccaaatacaacgacgacaagacccgatctgaagttttagaggattgaagacacgagagc 551
Query: 422 aaacagttaagacaaaatgtttctacgccgctgcactctactgntgctgatntgcctaat 481
||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||
Sbjct: 552 aaacagttaagacaaaatgtttctacgccgctgcactctactgctgctgatctgcctaat 611
Query: 482 tgcgaatgacgccgccagcgccgcacgcaaaacaaaagcgtcccgtcaaagccggtcaaa 541
||||| ||||||||||||||||||||||||||| ||||||||||||| |||||||||||
Sbjct: 612 tgcgagtgacgccgccagcgccgcacgcaaaac-aaagcgtcccgtc-aagccggtcaag 669
Query: 542 cagancaatccgcgcaacaatgtaacgccttcgccgcc-gntgtcgcctcatcnggggta 600
|||| ||||||||||| ||||||||||||||||||||| | |||||||||||| |||||
Sbjct: 670 cagaccaatccgcgcaccaatgtaacgccttcgccgccggctgtcgcctcatc--gggta 727
Query: 601 gttccacaacccgccagaaccagnaagcaccacca 635
||||||| ||||||||| ||||| ||||||||||
Sbjct: 728 gttccac-acccgccagcaccagc-agcaccacca 760
\#
anon- EST:Liang-2.48  = CG14938
>anon- EST:Liang-2.48 
aatcatgtac ggcaacatac aggcgagtcg ccgcacaagt gcacgtactg caccaagacg
ttcacgcgca aggagcacct gacgaaccat gtgcgccagc acacgggcga ctccccgcac
cgctgctcct actgcaagaa gaccttcacg cgcaaggagc acctgacgaa ccatgtgcgc
ctgcacacgg gcgactcgcc gcacaagtgc gagtactgcc agaagacgtt tacgcggaag
gagcacctga acaatcatat gcgccagcat tcgagcgaca atccgcattg ctgcaacgtt
tgcaacaagc cgtttacgcg caaggaacac ctgatcaacc atatgtcgcg gtgccacacc
ggtgaccggc ccttcacctg cgagacgtgc ggcaaatcgt tcccgctcaa gggcaatctg
ctcttccatc agcgcagcca taccaagggc caggaagatg gagcggccat tcgcctgcga
gaagtgcccc aagaacttca tctgcaaagg tcacttggtc tcgcacatgc gctcccattc
gggtgagaaa ccacacgcgt gcacactgtg caacaaggng ttcgtcnagc cgcggcaatt
tgaagcgcca catgaangat tgaatcaccc ggattgctat gntnccgnca ccaacccgtn
gaatccgcat tccgcaaata ccggntggtt gtgctgacgc aagtcaagca nggaagtgaa
aaccgattat tantttccca tcactctg
Database: dmel_all_transcript_r320
>CG14938-RC type=mRNA;
loc= 2L:complement (11783198..11786612,11786700..11786912,
11787536..11788273,11789026..11789193,11791776..11792545,
11792656..11792769,11794919..11795028,
11796885..11797843); ID=crol-RC; name=crol-RC;
db_xref='CG14938,FlyBase:FBgn0020309'; len=6487
Length = 6487
Genome Map
Score = 1194 bits (621), Expect = 0.0
Identities = 720/746 (96%), Gaps = 12/746 (1%)
Strand = Plus / Plus
Query: 1 aatcatgtacggcaacatacaggcgagtcgccgcacaagtgcacgtactgcaccaagacg 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2352 aatcatgtacggcaacatacaggcgagtcgccgcacaagtgcacgtactgcaccaagacg 2411
Query: 61 ttcacgcgcaaggagcacctgacgaaccatgtgcgccagcacacgggcgactccccgcac 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2412 ttcacgcgcaaggagcacctgacgaaccatgtgcgccagcacacgggcgactccccgcac 2471
Query: 121 cgctgctcctactgcaagaagaccttcacgcgcaaggagcacctgacgaaccatgtgcgc 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2472 cgctgctcctactgcaagaagaccttcacgcgcaaggagcacctgacgaaccatgtgcgc 2531
Query: 181 ctgcacacgggcgactcgccgcacaagtgcgagtactgccagaagacgtttacgcggaag 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2532 ctgcacacgggcgactcgccgcacaagtgcgagtactgccagaagacgtttacgcggaag 2591
Query: 241 gagcacctgaacaatcatatgcgccagcattcgagcgacaatccgcattgctgcaacgtt 300
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2592 gagcacctcaacaatcatatgcgccagcattcgagcgacaatccgcattgctgcaacgtt 2651
Query: 301 tgcaacaagccgtttacgcgcaaggaacacctgatcaaccatatgtcgcggtgccacacc 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2652 tgcaacaagccgtttacgcgcaaggaacacctgatcaaccatatgtcgcggtgccacacc 2711
Query: 361 ggtgaccggcccttcacctgcgagacgtgcggcaaatcgttcccgctcaagggcaatctg 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2712 ggtgaccggcccttcacctgcgagacgtgcggcaaatcgttcccgctcaagggcaatctg 2771
Query: 421 ctcttccatcagcgcagccataccaagggccaggaagatggagcggccattcgcctgcga 480
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 2772 ctcttccatcagcgcagccataccaagggccagg-agatggagcggccattcgcctgcga 2830
Query: 481 gaagtgccccaagaacttcatctgcaaaggtcacttggtctcgcacatgcgctcccattc 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2831 gaagtgccccaagaacttcatctgcaaaggtcacttggtctcgcacatgcgctcccattc 2890
Query: 541 gggtgagaaaccacacgcgtgcacactgtgcaacaaggngttcgtcnagccgcggcaatt 600
|||||||||||||||||||||||||||||||| ||||| ||||||| || ||||||||||
Sbjct: 2891 gggtgagaaaccacacgcgtgcacactgtgcagcaaggcgttcgtcgag-cgcggcaatt 2949
Query: 601 tgaagcgccacatgaangattgaatcacccggattgctatgntnccgncaccaacccgtn 660
|||||||||||||||| ||||||||||||| ||||||| | ||| |||| ||||||
Sbjct: 2950 tgaagcgccacatgaag--atgaatcacccgga-tgctatgatgccgccacc-acccgt- 3004
Query: 661 gaatccgcattccgcaaataccggntggttgtgctgacgcaagtcaagcanggaagtgaa 720
| ||||||| |||||||||||||| ||| ||||||||||||||||||||| ||||||| |
Sbjct: 3005 gcatccgca-tccgcaaataccggctgg-tgtgctgacgcaagtcaagca-ggaagtg-a 3060
Query: 721 aaccgattattantttcccatcactc 746
||||||| | || || ||||||||||
Sbjct: 3061 aaccgatca-taattccccatcactc 3085
\#
anon- EST:Liang-2.49  = CG3821
>anon- EST:Liang-2.49 
gaagtacacg acgctcgtga aatcaattcg tttgtgtatt aaaagggcaa gatctagctg
ccgtttttgt gcattccaag atggtcgagg acaaagagca agtggccaac ggggagcagg
tctccaagaa gggagccaaa aagctggcca aggccgctaa gaaagcgaac aaaaagcgga
gaacgcctcc accgcggcgg ccaataacgc tggtggcgat tctgcggagg atcacgccgc
cggaagatat ggcctctcgg aaatgatcca atccaaggac aaacgcagtg aacgcaactt
tgtcccggtt tcggaactaa gcggtcaggt gggcaaaggg ctggtctggg tgcgangacg
cgtccacact tcnagagcca agggaaagca ntgcttcctc atcctgcgcc agcagagcag
cacggtgcan ttgcatcctg gctgtcngtg atgttatctc caaacanatg gtcnaatttn
ccgggaaana tccctaaagg ggagcattan tggatatcca angncaaacc aaattgcggt
gtctaacaaa nattgaatcc tgcacaaanc aatccccngg naatntccct tcaancanat
attcnttaat atcccaagnc aaaggaacaa nttnncattt caaatccaag gntncatccc
gttcccnnaa aanccccttt atnccggaaa gggtctgaaa attnccgtta accanganaa
accccttgtg aaaaccnatt nttntacctt aaggaccccg ncaaattaag gccatttttc
caccgggaaa ccngggtttt ttt
Database: dmel_all_transcript_r320
>CG3821-asp-RA type=mRNA;
loc= 2R:join (7945033..7945094,7945484..7945584,
7945664..7945989,7946222..7947246,7947456..7947884);
ID=Aats-asp-RA; name=Aats-asp-RA;
db_xref='CG3821,FlyBase:FBgn0002069'; len=1943
Length = 1943
Genome Map
Score = 881 bits (458), Expect = 0.0
Identities = 537/565 (95%), Gaps = 8/565 (1%)
Strand = Plus / Plus
Query: 3 agtacacgacgctcgtgaaatcaattcgtttgtgtattaaaagggcaagatctagctgcc 62
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5 agtacacgacgctcgtgaaatcaattcgtttgtgtattaaaagggcaagatctagctgcc 64
Query: 63 gtttttgtgcattccaagatggtcgaggacaaagagcaagtggccaacggggagcaggtc 122
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 65 gtttttgtgcattccaagatggtcgaggacaaagagcaagtggccaacggggagcaggtc 124
Query: 123 tccaagaagggagccaaaaagctggccaaggccgctaagaaagc-gaacaaaaagcggag 181
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 125 tccaagaagggagccaaaaagctggccaaggccgctaagaaagccgaacaaaaagcggag 184
Query: 182 aacgcctccaccgcggcggccaataacgctggtggcgattctgcggaggatcacgccgcc 241
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 185 aacgcctccaccgcggcggccaataacgctggtggcgattctgcggaggatcacgccgcc 244
Query: 242 ggaagatatggcctctcggaaatgatccaatccaaggacaaacgcagtgaacgcaacttt 301
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 245 ggaagatatggcctctcggaaatgatccaatccaaggacaaacgcagtgaacgcaacttt 304
Query: 302 gtcccggtttcggaactaagcggtcaggtgggcaaagggctggtctgggtgcgangacgc 361
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||
Sbjct: 305 gtcccggtttcggaactaagcggtcaggtgggcaaaggactggtctgggtgcgaggacgc 364
Query: 362 gtccacacttcnagagccaagggaaagcantgcttcctcatcctgcgccagcagagcagc 421
||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 365 gtccacacttcgagagccaagggaaagcagtgcttcctcatcctgcgccagcagagcagc 424
Query: 422 acggtgcanttgcatcctggctgtcngtgatgttatctccaaacanatggtcnaatttnc 481
|||||||| ||||||||||||||| ||||||||||||||||||| |||||| |||||
Sbjct: 425 acggtgcag-tgcatcctggctgtcggtgatgttatctccaaacagatggtcaaatttg- 482
Query: 482 cgggaaanatccctaaaggggagcattantggatatccaangncaaaccaaattgcggtg 541
||||||| |||||| |||| |||||||| | |||||||| | | || | | | ||||||
Sbjct: 483 cgggaaatatccct-aaggagagcattatt-gatatcca--ggccaagccagtggcggtg 538
Query: 542 tctaacaaanattgaatcctgcaca 566
|||| | || |||||||||||||||
Sbjct: 539 tctagc-aagattgaatcctgcaca 562
\#
anon- EST:Liang-2.51  == CG7533 (charybde) (1-635 only; chimeric? Last
150bp not identifiable \-- het?)
\#
anon- EST:Liang-2.54  == CG9894
\#
anon- EST:Liang-20  == CG10035
\#
anon- EST:Liang-38  == CG17579 (sca)
\#
anon- EST:Liang-97  == CG3359 (1-468 only; chimeric cDNA? Last 300bp not
identifiable \-- het?)
\#
Date: Wed, 30 Jun 2004  18:23:22  \+0100 (BST)
From: 'Michael Ashburner (Genetics)' <ma11@XXXX>
Subject: Death to anon-ESTs
To: michaelXXXX, crosbyXXXX
Cc: gm119@XXXX
Some more \- will start on Poseys
Michael
anon- EST:Gibbs1  = ? maybe new
anon- EST:Gibbs2  = ? maybe new
anon- EST:GressD1  == ? maybe new or junk
anon- EST:GressD10  = CG9253, I think (must be ?:)
anon- EST:GressD11  = ?, only self match
anon- EST:GressD16  = CG6483
anon- EST:GressD4  = CG4863
anon- EST:GressD5  = CG2934
anon- EST:GressD7  = CG6667
anon- EST:Nelson1  = CG4065
anon- EST:ParkEST125  = CG4182
anon- EST:ParkEST132  = CG10992
anon- EST:ParkEST325  = CG6199
===================================
anon- EST:Gibbs1  = ? maybe new
>anon- EST:Gibbs1.1 
gaattcggct tcgacgggac caccttatgt tatttcatca tggcctcgac gttcgctaac
agagctgagc actgttaagc ggcgcttcgt gactgtgagc cgaacgcata cgaacgacct
acgccagcgc gctcaaacct gttggccaac tgagtgtgca acaaacatgt tgtgtttacg
ttttttcctt ggcctaagcg gtttgagcat gttgctgtcc tccatcaaca tgttgcactt
ttcgggcttg gcaacaagtg ctttttgttt ccaacttcca gatactcttt ctatttaact
gtatttatgg ttgtagttat attacgccgt taattgtgaa atgttaccaa tgagtattgc
atataaaaat catttaaaat ttacatatta caaactcaag ctgattttat taaaattaaa
tgtatatatc taagtcctat tcaaaaaaaa aacgtatcaa cagaagctgc gtaatatatt
gcttaattca aattggacat tcagccgaaa taaaaatatc tttgacagat acactaggaa
gctctgacac ggcgaaaagt aggacaaaat cggttcaggg gagatggtca ttgtgggtgg
acgcgttcag cggggagctg taacttttct aactggcatt tttccgcaat gattgcagtt
gaacacgctg cgataaaagc taatcgaatt atgcttttgg caaatgccac aacagctgca
cgaaaccagc aaaaactaac aaacaattat gggtctctca actggggcgg ggaatgggaa
aatcgaatag ggggagaatg gtcaagggtg gcttataact ctgctatgtg cggcgtcatg
tcaacgccca gccaagcaaa gcgaggacca aaaggagacg cagcggtttg gagtttccgg
caaaaagtta gtgggcaaag gaaagagcca aaaagggatt tgtgtatgcg aaaaaatttt
acaagccatt aacaaaaatg ttgcgcctcg gcatatgcca cataaaattc actcagcagc
agcagcagca gcagtggtaa caatggagga gtcaggcgcc taactcaggc acacacagat
ggaaagcgag tggaacggtc ggaaaataag cggcataacc gcattcccaa tacgctatcc
aaaatattat agccctagaa aagggtagca tttgctcttt catcagtaga gaattatgat
tatttaagaa cagataaata attaaacttt ttataataaa tgttcaacta tcaatcgctg
cagcttaata tatcttctgc atatattctt tcctcatggg caggtatgta catatatgaa
tggagaaaac tcaattatcc tttgtgaggg tactgaaaag agcgaaacaa agagagagac
tgatgcaaaa aggaaggagg ggcgaaaagc gagtcgaatg ccaaaatgtg caatggaag
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003679 |gb|AE003679| arm:3R  4269603..4486596
estimated- cyto:85A1-85A5  gadfly- seqname:AE003679 
 seq_release:3 
Length = 216994
Score = 2527 bits (1314), Expect = 0.0 Genome Map
Identities = 1359/1397 (97%)
Strand = Plus / Plus
Query: 43 gcctcgacgttcgctaacagagctgagcactgttaagcggcgcttcgtgactgtgagccg 102
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 33811 gcctcgacgttcgctaacagagctgagcactgttaagcggcgcttcgtgactgtgagccg 33870
Query: 103 aacgcatacgaacgacctacgccagcgcgctcaaacctgttggccaactgagtgtgcaac 162
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 33871 aacgcatacgaacgacctacgccagcgcgctcaaacctgttggccaactgagtgtgcaac 33930
Query: 163 aaacatgttgtgtttacgttttttccttggcctaagcggtttgagcatgttgctgtcctc 222
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 33931 aaacatgttgtgtttacgttttttccttggcctaagcggtttgagcgtgttgctgtcctc 33990
Query: 223 catcaacatgttgcacttttcgggcttggcaacaagtgctttttgtttccaacttccaga 282
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 33991 catcaacatgttgcacttttcgggcttggcaacaagtgctttttgtttccaactaccaga 34050
Query: 283 tactctttctatttaactgtatttatggttgtagttatattacgccgttaattgtgaaat 342
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 34051 tactctttctatttaactgtatttatggttgtagttatattatgccgttaattgtgaaat 34110
Query: 343 gttaccaatgagtattgcatataaaaatcatttaaaatttacatattacaaactcaagct 402
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 34111 gttaccaatgagtattgcatataaaaatcatttaaaatttacatattacaaactcaagct 34170
Query: 403 gattttattaaaattaaatgtatatatctaagtcctattcnnnnnnnnnncgtatcaaca 462
|||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 34171 gattttattaaaattaaatgtatatatctaagtcctattcaaaaaaaaaacgtatcaaca 34230
Query: 463 gaagctgcgtaatatattgcttaattcaaattggacattcagccgaaataaaaatatctt 522
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 34231 gaagctgcgtaatatattgcttaattcaaattggacattcagccgaaataaaaatatttt 34290
Query: 523 tgacagatacactaggaagctctgacacggcgaaaagtaggacaaaatcggttcagggga 582
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 34291 tgacagatacactaggaagctctgacacggcaaaaagtaggacaaaatcggttcagggga 34350
Query: 583 gatggtcattgtgggtggacgcgttcagcggggagctgtaacttttctaactggcatttt 642
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 34351 gatggtcattgtgggtggacgcgttcagcggggagctgtaacttttctaattggcatttt 34410
Query: 643 tccgcaatgattgcagttgaacacgctgcgataaaagctaatcgaattatgcttttggca 702
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 34411 tccgcaatgattgcagttgaacacgctgcgataaaagctaatcgaattatgcttttggca 34470
Query: 703 aatgccacaacagctgcacgaaaccagcaaaaactaacaaacaattatgggtctctcaac 762
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 34471 aatgccacaacagctgcacgaaaccagcaaaaactaacaaacaattatgggtctctcaac 34530
Query: 763 tggggcggggaatgggaaaatcgaatagggggagaatggtcaagggtggcttataactct 822
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 34531 tggggcggggaatgggaaaatcgaatagggggagaatgggcaagggtggcttataactct 34590
Query: 823 gctatgtgcggcgtcatgtcaacgcccagccaagcaaagcgaggaccaaaaggagacgca 882
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 34591 gctatgtgcggcgtcatgtcaacgcccagccaagcaaagcgaggaccaaaaggagacgca 34650
Query: 883 gcggtttggagtttccggcaaaaagttagtgggcaaaggaaagagccaaaaagggatttg 942
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 34651 gcggtttggagtttccggcaaaaagttagtgggcaaaggaaagagccaaaaagggatttg 34710
Query: 943 tgtatgcgaaaaaattttacaagccattaacaaaaatgttgcgcctcggcatatgccaca 1002
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 34711 tgtatgcgaaaaaattttacaagccattaacaaaaatgttgcgcctcggcatatgccaca 34770
Query: 1003 taaaattcactnnnnnnnnnnnnnnnnnnnnntggtaacaatggaggagtcaggcgccta 1062
||||||||||| ||||||||||||||||||||||||||||
Sbjct: 34771 taaaattcactcagcagcagcagcagcagcagtggtaacaatggaggagtcaggcgccta 34830
Query: 1063 actcaggcacacacagatggaaagcgagtggaacggtcggaaaataagcggcataaccgc 1122
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 34831 actcaggcacacacagatggaaagcgagtggaacggtcggaaaataagcggcataaccgc 34890
Query: 1123 attcccaatacgctatccaaaatattatagccctagaaaagggtagcatttgctctttca 1182
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 34891 attcccaatacgctatccaaaatattatagccctagaaaagggtagcatttgctctttca 34950
Query: 1183 tcagtagagaattatgattatttaagaacagataaataattaaactttttataataaatg 1242
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 34951 tcagtagagaattatgattatttaagaacagataaataattaaactttttataataaatg 35010
Query: 1243 ttcaactatcaatcgctgcagcttaatatatcttctgcatatattctttcctcatgggca 1302
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 35011 ttcaactatcaatcgctgcagcttaatatatcttctgcatatattctttcctcatgggca 35070
Query: 1303 ggtatgtacatatatgaatggagaaaactcaattatcctttgtgagggtactgaaaagag 1362
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 35071 ggtatgtacatatatgaatggagaaaactcaattatcctttgtgagggtactgaaaagag 35130
Query: 1363 cgaaacaaagagagagactgatgcaaaaaggaaggaggggcgaaaagcgagtcgaatgcc 1422
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 35131 cgaaacaaagagagagactgatgcaaaaaggaaggaggggcgaaaagcgagtcgaatgcc 35190
Query: 1423 aaaatgtgcaatggaag 1439
|||||||||||||||||
Sbjct: 35191 aaaatgtgcaatggaag 35207
>anon- EST:Gibbs1.2 
gcctcgacgt tcgctaacag agctgagcac tgttaagcgg cgcttcgtga ctgtgagccg
aacgcatacg aacgacctac gccagcgcgc tcaaacctgt tggccaactg agtgtgcaac
aaacatgttg tgtttacgtt ttttccttgg cctaagcggt ttgagcgtgt tgctgtcctc
catcaacatg ttgcactttt cgggcttggc aacaagtgct ttttgtttcc aactaccaga
tactctttct atttaactgt atttatggtt gtagttatat tatgccgtta attgtgaaat
gttaccaatg agtattgcat ataaaaatca tttaaaattt acatattaca aactcaagct
gattttatta aaattaaatg tatatatcta agtcctattc aaaaaaaaaa cgtatcaaca
gaagctgcgt aatatattgc ttaattcaaa ttggacattc agcccgaata aaatattttt
gacagatcac taggaagctc tgacacggaa aaa
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003679 |gb|AE003679| arm:3R  4269603..4486596
estimated- cyto:85A1-85A5  gadfly- seqname:AE003679 
 seq_release:3 
Length = 216994
Score = 904 bits (470), Expect = 0.0 Genome Map
Identities = 500/515 (97%), Gaps = 2/515 (0%)
Strand = Plus / Plus
Query: 1 gcctcgacgttcgctaacagagctgagcactgttaagcggcgcttcgtgactgtgagccg 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 33811 gcctcgacgttcgctaacagagctgagcactgttaagcggcgcttcgtgactgtgagccg 33870
Query: 61 aacgcatacgaacgacctacgccagcgcgctcaaacctgttggccaactgagtgtgcaac 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 33871 aacgcatacgaacgacctacgccagcgcgctcaaacctgttggccaactgagtgtgcaac 33930
Query: 121 aaacatgttgtgtttacgttttttccttggcctaagcggtttgagcgtgttgctgtcctc 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 33931 aaacatgttgtgtttacgttttttccttggcctaagcggtttgagcgtgttgctgtcctc 33990
Query: 181 catcaacatgttgcacttttcgggcttggcaacaagtgctttttgtttccaactaccaga 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 33991 catcaacatgttgcacttttcgggcttggcaacaagtgctttttgtttccaactaccaga 34050
Query: 241 tactctttctatttaactgtatttatggttgtagttatattatgccgttaattgtgaaat 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 34051 tactctttctatttaactgtatttatggttgtagttatattatgccgttaattgtgaaat 34110
Query: 301 gttaccaatgagtattgcatataaaaatcatttaaaatttacatattacaaactcaagct 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 34111 gttaccaatgagtattgcatataaaaatcatttaaaatttacatattacaaactcaagct 34170
Query: 361 gattttattaaaattaaatgtatatatctaagtcctattcnnnnnnnnnncgtatcaaca 420
|||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 34171 gattttattaaaattaaatgtatatatctaagtcctattcaaaaaaaaaacgtatcaaca 34230
Query: 421 gaagctgcgtaatatattgcttaattcaaattggacattcagcccgaat-aaaatatttt 479
|||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||
Sbjct: 34231 gaagctgcgtaatatattgcttaattcaaattggacattcagccgaaataaaaatatttt 34290
Query: 480 tgacagat-cactaggaagctctgacacggaaaaa 513
|||||||| ||||||||||||||||||||| ||||
Sbjct: 34291 tgacagatacactaggaagctctgacacggcaaaa 34325
\#
anon- EST:Gibbs2  = ? maybe new
>anon- EST:Gibbs2 
gaattccata atttataatc cttgctctgg acccccagca acaataatac caacaacaac
aacaacaaca acaacaacaa caacagcagc agcagcaaca agaacaaaca cagcaacagg
agcaggagta acaagagcag aaataatatg ggaatgccag tgcaaatatt tttgcttgca
cctctcggtt tctatgatcc gagtttcctt ttacttttat gtcctatttt atttattcga
aacctgtgcc tctcccaggt tggcagcaca aatattttgt tggttccctt ccgagccacc
cagccactat ttcacacccg ctcggctgca tttagtttat gtgtgtgtta ccttttttct
cggtaaaatg aggtcaaaag tttattggct aataaatgtg tgcgcaagtg ggtggggtgt
tgttttcgca ggcattaatg tcaggcgcaa actgcagagg ctgcaaagtt tttggcagag
ctttaatgcc gataaacaaa ttgcatgcac ttagctacag gccgcccatc caaaaggaga
tgggcaggat tagggcagtc gaaatgggct ttaaatgatc ctgcagcaca ctcgatggca
cgatggccac aaaagcgaat cagctgccct accgacggct aattacaaac taatcagcca
acaaataaat ttcaaataaa ttatacaaga acggaattgg ctaatgcatt gcagttgaac
gacagccaga gcgaaacaaa aaacttcaaa tctatgttgg gccaaccaaa ccgaacgaaa
gcaaaccaaa ccaagccaaa actgccaaac acaccaaaat tttaagctat tcaattatgg
ttcgttcaaa aagaacagca aaactatttt aattatttac attaagcccc tcaacatgtt
tggccgacac acaagctctt ttctccaatt aaactgggaa taggatctag ctggcaaggg
aaaccggcat agaatatctc attcgcattc acattcgact gaacatcaac cgatgtgctg
taattcagaa cgggccgaaa gattcgagtt tcctctgatc agcccaaggt gaacttatag
gcccccactc cctagaagaa ctaagttgtt cgccgtaaaa gcatttggtt caatgtttaa
tgagggtggg ctcaataata gagaaagcct accttttatg cttgcctctt cccccgctgg
gaaaacaacc ccttccaacg aataatgatt atgacagctt ctttgccgat gagcgactct
gctcctgtca tttcgcactg gtttccactg tacctctgcc agatttgctg gctgcttggg
ctttaattaa acggcaattg tggtcatcag ttgtcaggtt ctcttgtgcc taatcagttt
gtgtgatgaa agactaagct gggattacgg aatgtctgcc atgcgggtgc gacatttgaa
taatgaatgt caactcgatg ttcggcttgc aggggaaaaa tataagcccg acctaagtcc
caaatgtcac tcagctgtca attgtaagca aatctaagga gcagagattc gggcggtttc
gctagcggag gaggccaact aattggggcg tggccggttt cggccagctg acaaactaac
tgaccaacta actgacgtaa ctaggcaagg caattggcct gcccgttagt ccgcccctcc
atttgttcat ttgtccatgt cagttagctt ggccttctgt gtgcttgctg cttgaccata
aactaatgca cctaattgct gtgattatgt cgtttgtgat tatctaagtg tgcccccgtg
tccttgtccc cgtttccgtc ttctggagag ttctgtgcct ctgattttgc cattgcaatg
cattgaccgc ctgcatgcgc tgcatacaat taggcacaaa acctaaatct catttatcaa
tcacgagtcc tccggcgttc ggcgcgataa tatttgataa ttggccaaag ccattactga
tagtcccagc tggatcagaa ttc
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003597 |gb|AE003597| arm:3L  22100943..22406554
estimated- cyto:79D1-79E5  gadfly- seqname:AE003597 
 seq_release:3 
Length = 305612
Score = 3584 bits (1864), Expect = 0.0 Genome Map
Identities = 1878/1885 (99%)
Strand = Plus / Plus
Query: 119 ggagcaggagtaacaagagcagaaataatatgggaatgccagtgcaaatatttttgcttg 178
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 147665 ggagcaggagtaacaagagcagaaataatatgggaatgccagtgcaaatatttttgcttg
147724
Query: 179 cacctctcggtttctatgatccgagtttccttttacttttatgtcctattttatttattc 238
| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 147725 ctcctctcggtttctatgatccgagtttccttttacttttttgtcctattttatttattc
147784
Query: 239 gaaacctgtgcctctcccaggttggcagcacaaatattttgttggttcccttccgagcca 298
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 147785 gaaacctgtgcctctcccaggttggcagcacaaatattttgttggttcccttccgagcca
147844
Query: 299 cccagccactatttcacacccgctcggctgcatttagtttatgtgtgtgttacctttttt 358
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 147845 cccagccactatttcacacccgctcggctgcatttagtttatgtgtgtgttacctttttt
147904
Query: 359 ctcggtaaaatgaggtcaaaagtttattggctaataaatgtgtgcgcaagtgggtggggt 418
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 147905 ctcggtaaaatgaggtcaaaagtttattggctaataaatgtgtgcgcaagtgggtggggt
147964
Query: 419 gttgttttcgcaggcattaatgtcaggcgcaaactgcagaggctgcaaagtttttggcag 478
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 147965 gttgttttcgcaggcattaatgtcaggcgcaaactgcagaggctgcaaagtttttggcag
148024
Query: 479 agctttaatgccgataaacaaattgcatgcacttagctacaggccgcccatccaaaagga 538
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 148025 agctttaatgccgataaacaaattgcatgcacttagctacaggccgcccatccaagggga
148084
Query: 539 gatgggcaggattagggcagtcgaaatgggctttaaatgatcctgcagcacactcgatgg 598
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148085 gatgggcaagattagggcagtcgaaatgggctttaaatgatcctgcagcacactcgatgg
148144
Query: 599 cacgatggccacaaaagcgaatcagctgccctaccgacggctaattacaaactaatcagc 658
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148145 cacgatggccacaaaagcgaatcagctgccctaccgacggctaattacaaactaatcagc
148204
Query: 659 caacaaataaatttcaaataaattatacaagaacggaattggctaatgcattgcagttga 718
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148205 caacaaataaatttcaaataaattatacaagaacggaattggctaatgcattgcagttga
148264
Query: 719 acgacagccagagcgaaacaaaaaacttcaaatctatgttgggccaaccaaaccgaacga 778
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148265 acgacagccagagcgaaacaaaaaacttcaaatctatgttgggccaaccaaaccgaacga
148324
Query: 779 aagcaaaccaaaccaagccaaaactgccaaacacaccaaaattttaagctattcaattat 838
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148325 aagcaaaccaaaccaagccaaaactgccaaacacaccaaaattttaagctattcaattat
148384
Query: 839 ggttcgttcaaaaagaacagcaaaactattttaattatttacattaagcccctcaacatg 898
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148385 ggttcgttcaaaaagaacagcaaaactattttaattatttacattaagcccctcaacatg
148444
Query: 899 tttggccgacacacaagctcttttctccaattaaactgggaataggatctagctggcaag 958
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148445 tttggccgacacacaagctcttttctccaattaaactgggaataggatctagctggcaag
148504
Query: 959 ggaaaccggcatagaatatctcattcgcattcacattcgactgaacatcaaccgatgtgc 1018
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148505 ggaaaccggcatagaatatctcattcgcattcacattcgactgaacatcaaccgatgtgc
148564
Query: 1019 tgtaattcagaacgggccgaaagattcgagtttcctctgatcagcccaaggtgaacttat 1078
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148565 tgtaattcagaacgggccgaaagattcgagtttcctctgatcagcccaaggtgaacttat
148624
Query: 1079 aggcccccactccctagaagaactaagttgttcgccgtaaaagcatttggttcaatgttt 1138
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148625 aggcccccactccctagaagaactaagttgttcgccgtaaaagcatttggttcaatgttt
148684
Query: 1139 aatgagggtgggctcaataatagagaaagcctaccttttatgcttgcctcttcccccgct 1198
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 148685 aatgagggtgggctcaataatacagaaagcctaccttttatgcttgcctcttcccccgct
148744
Query: 1199 gggaaaacaaccccttccaacgaataatgattatgacagcttctttgccgatgagcgact 1258
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148745 gggaaaacaaccccttccaacgaataatgattatgacagcttctttgccgatgagcgact
148804
Query: 1259 ctgctcctgtcatttcgcactggtttccactgtacctctgccagatttgctggctgcttg 1318
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148805 ctgctcctgtcatttcgcactggtttccactgtacctctgccagatttgctggctgcttg
148864
Query: 1319 ggctttaattaaacggcaattgtggtcatcagttgtcaggttctcttgtgcctaatcagt 1378
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148865 ggctttaattaaacggcaattgtggtcatcagttgtcaggttctcttgtgcctaatcagt
148924
Query: 1379 ttgtgtgatgaaagactaagctgggattacggaatgtctgccatgcgggtgcgacatttg 1438
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148925 ttgtgtgatgaaagactaagctgggattacggaatgtctgccatgcgggtgcgacatttg
148984
Query: 1439 aataatgaatgtcaactcgatgttcggcttgcaggggaaaaatataagcccgacctaagt 1498
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148985 aataatgaatgtcaactcgatgttcggcttgcaggggaaaaatataagcccgacctaagt
149044
Query: 1499 cccaaatgtcactcagctgtcaattgtaagcaaatctaaggagcagagattcgggcggtt 1558
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 149045 cccaaatgtcactcagctgtcaattgtaagcaaatctaaggagcagagattcgggcggtt
149104
Query: 1559 tcgctagcggaggaggccaactaattggggcgtggccggtttcggccagctgacaaacta 1618
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 149105 tcgctagcggaggaggccaactaattggggcgtggccggtttcggccagctgacaaacta
149164
Query: 1619 actgaccaactaactgacgtaactaggcaaggcaattggcctgcccgttagtccgcccct 1678
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 149165 actgaccaactaactgacgtaactaggcaaggcaattggcctgcccgttagtccgcccct
149224
Query: 1679 ccatttgttcatttgtccatgtcagttagcttggccttctgtgtgcttgctgcttgacca 1738
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 149225 ccatttgttcatttgtccatgtcagttagcttggccttctgtgtgcttgctgcttgacca
149284
Query: 1739 taaactaatgcacctaattgctgtgattatgtcgtttgtgattatctaagtgtgcccccg 1798
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 149285 taaactaatgcacctaattgctgtgattatgtcgtttgtgattatctaagtgtgcccccg
149344
Query: 1799 tgtccttgtccccgtttccgtcttctggagagttctgtgcctctgattttgccattgcaa 1858
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 149345 tgtccttgtccccgtttccgtcttctggagagttctgtgcctctgattttgccattgcaa
149404
Query: 1859 tgcattgaccgcctgcatgcgctgcatacaattaggcacaaaacctaaatctcatttatc 1918
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 149405 tgcattgaccgcctgcatgcgctgcatacaattaggcacaaaacctaaatctcatttatc
149464
Query: 1919 aatcacgagtcctccggcgttcggcgcgataatatttgataattggccaaagccattact 1978
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 149465 aatcacgagtcctccgccgttcggcgcgataatatttgataattggccaaagccattact
149524
Query: 1979 gatagtcccagctggatcagaattc 2003
|||||||||||||||||||||||||
Sbjct: 149525 gatagtcccagctggatcagaattc 149549
\#
anon- EST:GressD1  == ? maybe new or junk
>anon- EST:GressD1 
ttttctccaa atttcaaggg tctcaaatcg gattttttaa acaaaacctc gaaaaaatac
tcaaaaactg aattgaccgg tgattaaaat ggaccgcctt tacaagacga gtggagtcgc
ggacgatcta atggaccgat gtcgattaac gcgacaccca gcggcgaggg cagatcgcac
ggcg
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003816 |gb|AE003816| arm:2R  8923493..9210836
estimated- cyto:50C6-50E1  gadfly- seqname:AE003816 
 seq_release:3 
Length = 287344
Score = 123 bits (64), Expect = 1e-27 Genome Map
Identities = 89/94 (94%), Gaps = 3/94 (3%)
Strand = Plus / Plus
Query: 1 ttttctccaaatttcaagggtctcaaatcggattttttaaacaaaacctcgaaaaaatac 60
|||||||||||||||| | ||||||||||| ||||||||||||||||||||||||| |||
Sbjct: 3234 ttttctccaaatttcaggtgtctcaaatcg-attttttaaacaaaacctcgaaaaa-tac 3291
Query: 61 tcaaaaactgaattgaccggtgattaaaatggac 94
||||||||||||||||||||||| ||||||||||
Sbjct: 3292 tcaaaaactgaattgaccggtga-taaaatggac 3324
>gadfly| SEG:AE003441 |gb|AE003441| arm:X  7253939..7539888
estimated- cyto:7B3-7B8  gadfly- seqname:AE003441 
 seq_release:3 
Length = 285950
Score = 37.2 bits (19), Expect = 0.13 Genome Map
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 24 caaatcggattttttaaac 42
|||||||||||||||||||
Sbjct: 80234 caaatcggattttttaaac 80216
Score = 31.5 bits (16), Expect = 7.2 Genome Map
Identities = 18/19 (94%)
Strand = Plus / Plus
Query: 28 tcggattttttaaacaaaa 46
||||| |||||||||||||
Sbjct: 79134 tcggactttttaaacaaaa 79152
\#
anon- EST:GressD10  = CG9253, I think (must be ?:)
>anon- EST:GressD10 
tacaaacgag tgacgaaggg aggatctagg tagcggagcc aggaaatgaa gataacaatc
ataaggaagg ggacagcagc actaagtgtg aagatgataa atccgaggat gaccgaggaa
cagaagctaa cctggaagat ctggtctcaa tgaggcttgt gtcagcatgt gacgaattga
agtgga
Query= anon- EST:GressD10 
>CG9253-RA type=mRNA;
loc= 2L:join (21112976..21113247,21113308..21113566,
21113756..21114895); ID=CG9253-RA; name=CG9253-RA;
db_xref='CG9253,FlyBase:FBgn0032919'; len=1671
Length = 1671
Genome Map
Score = 135 bits (70), Expect = 1e-31
Identities = 180/210 (85%), Gaps = 24/210 (11%)
Strand = Plus / Plus
Query: 1 tacaaacgagtgacgaag-ggaggatctaggtagcg-----gagccaggaaatgaagata 54
|||||||||||||||||| ||||||||||||||||| |||| | | |||||||||
Sbjct: 109 tacaaacgagtgacgaagaggaggatctaggtagcgaggaggagcaggaagatgaagata 168
Query: 55 acaatcataaggaaggggacagca-----gcactaagtg-tgaagatgataaa---tccg 105
||||||||||||||||||||||| |||||||||| ||||||||||||| ||||
Sbjct: 169 acaatcataaggaaggggacagcgaggcggcactaagtggtgaagatgataaaggctccg 228
Query: 106 aggatgac-----cgaggaacagaagctaacctgg-aagatct-ggtctcaatgaggc-t 157
|||| ||| |||||||||||||||||||||| ||||||| |||||||||||||| |
Sbjct: 229 aggacgacgcagccgaggaacagaagctaacctggaaagatctcggtctcaatgaggctt 288
Query: 158 tgtgtc-agcatgtgacgaattgaagtgga 186
|||||| |||||||||||||||||||||||
Sbjct: 289 tgtgtcaagcatgtgacgaattgaagtgga 318
\#
anon- EST:GressD11  = ?, only self match
\*z FBgn0025330
\*g X65274
>anon- EST:GressD11 
gaaataccca gtagataaaa ataaaacaga agtaaaaggc tgcataaaaa ataaattcca
attgaagctc tagcaagttc acttcgtttt cgatacgagt gacaaaaaga gaccacatat
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 2,262,611
sequences; 10,883,439,008 total letters
If you have any problems or questions with the results of this search
please refer to the BLAST FAQs
\#
anon- EST:GressD16  = CG6483
>anon- EST:GressD16 
ccctggctct ggccagcctc cgccggtctg ctgccccagc gagtgccgat ccacccccgt
gacctgcccg ccgtgaccaa gatcgagggt cgcatcacca atggcaagac cgccacttct
ggccagttcc ctaccaggtg ggactcagct tcgccagcac c
Database: dmel_all_transcript_r320
>CG6483-RA type=mRNA;
loc= 3L:join (6010082..6010344,6010404..6011008); Genome Map
ID=CG6483-RA; name=CG6483-RA;
db_xref='CG6483,FlyBase:FBgn0035665'; len=868
Length = 868
Score = 256 bits (133), Expect = 4e-68
Identities = 157/164 (95%), Gaps = 3/164 (1%)
Strand = Plus / Plus
Query: 1 ccctggctctggcca--gcctccgccggtctgctgccccagcgagtgccgatccaccccc 58
||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 26 ccctggctctggccaccgcctccgccggtctgctgccccagcaggtgccgatccaccccc 85
Query: 59 gtgacctgcccgccgtgaccaagatcgagggtcgcatcaccaatggcaagaccgccactt 118
|||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||
Sbjct: 86 gtgacctgcccgccgtgaccaatatcgagggtcgcatcaccaacggcaagaccgccactt 145
Query: 119 ctggccagtt-ccctaccaggtgggactcagcttcgccagcacc 161
|||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 146 ctggccagttcccctaccaggtgggactcagcttcgccagcacc 189
\#
anon- EST:GressD4  = CG4863
>anon- EST:GressD4 
agcgatcaat aaacagattt tgggctaagc tgactcgaag atgcatctaa tggaaaagac
cacgtacaga tttacatcga tatgtgatag agtgatcata tagtatctca t
Database: dmel_all_transcript_r320
>CG4863-RB type=mRNA;
loc= 3R:join (7047909..7048107,7048301..7048469,
7049135..7049270,7049598..7049987,7050231..7050915);
ID=RpL3-RB; name=RpL3-RB;
db_xref='CG4863,FlyBase:FBgn0020910'; len=1579
Length = 1579
Genome Map
Score = 54.5 bits (28), Expect = 2e-07
Identities = 35/36 (97%), Gaps = 1/36 (2%)
Strand = Plus / Plus
Query: 1 agcgatcaataaacagattttgggctaagctgactc 36
||||||||||||||||||||| ||||||||||||||
Sbjct: 1318 agcgatcaataaacagatttt-ggctaagctgactc 1352
Score = 35.3 bits (18), Expect = 0.093
Identities = 32/34 (94%), Gaps = 2/34 (5%)
Strand = Plus / Plus
Query: 42 tgcatctaatgg-aaaagaccacgt-acagattt 73
|||||||||||| |||||||||||| ||||||||
Sbjct: 1368 tgcatctaatgggaaaagaccacgtcacagattt 1401
>CG4863-RE type=mRNA;
loc= 3R:join (7047659..7048107,7048301..7048469,
7049135..7049270,7049598..7049987,7050231..7050915);
ID=RpL3-RE; name=RpL3-RE;
db_xref='CG4863,FlyBase:FBgn0020910'; len=1829
Length = 1829
Genome Map
Score = 54.5 bits (28), Expect = 2e-07
Identities = 35/36 (97%), Gaps = 1/36 (2%)
Strand = Plus / Plus
Query: 1 agcgatcaataaacagattttgggctaagctgactc 36
||||||||||||||||||||| ||||||||||||||
Sbjct: 1568 agcgatcaataaacagatttt-ggctaagctgactc 1602
Score = 35.3 bits (18), Expect = 0.093
Identities = 32/34 (94%), Gaps = 2/34 (5%)
Strand = Plus / Plus
Query: 42 tgcatctaatgg-aaaagaccacgt-acagattt 73
|||||||||||| |||||||||||| ||||||||
Sbjct: 1618 tgcatctaatgggaaaagaccacgtcacagattt 1651
\#
anon- EST:GressD5  = CG2934
>anon- EST:GressD5 
ccacacaatt cgcgcaactt tcggtcgagc gagagcagtc ccatagaaag gaatccagcg
caattcgcca cctcttcaac ttcagtcagc tcctctgcgt gtgtgtgtgt gcgtgtgtca
tcaagatggc ttcagtcagc tcctctgcgt gtgtgtgtgt gcgtgtgtca tcaagatg
Database: dmel_all_transcript_r320
>CG2934-RA type=mRNA;
loc= X:join (3621356..3621731,3622070..3622578,
3622669..3623587); ID=VhaAC39-RA; name=VhaAC39-RA;
db_xref='CG2934,FlyBase:FBgn0028665'; len=1804
Length = 1804
Genome Map
Score = 175 bits (91), Expect = 9e-44
Identities = 98/99 (98%), Gaps = 1/99 (1%)
Strand = Plus / Plus
Query: 1 ccacacaattcgcgcaactttcggtcgagcgagagcagtcccatagaaaggaatccagcg 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 124 ccacacaattcgcgcaactttcggtcgagcgagagcagtcccatagaaaggaatccagcg 183
Query: 61 caattcgccacctcttcaactt-cagtcagctcctctgc 98
|||||||||||||||||||||| ||||||||||||||||
Sbjct: 184 caattcgccacctcttcaacttccagtcagctcctctgc 222
Score = 31.5 bits (16), Expect = 2.3
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 133 cagtcagctcctctgc 148
||||||||||||||||
Sbjct: 207 cagtcagctcctctgc 222
\#
anon- EST:GressD7  = CG6667
>anon- EST:GressD7 
aaaagaaggc tgcataaaaa cggcataaat tcaattgaac gtctaaagca agtcacttgc
tttttt
Database: dmel_all_transcript_r320
>CG6667-RC type=mRNA;
loc= 2L:complement (17416681..17419962,17420023..17420417,
17420487..17420665,17420735..17421088,
17427379..17427451,17427959..17428442); ID=dl-RC;
name=dl-RC; db_xref='CG6667,FlyBase:FBgn0000462';
len=4767
Length = 4767
Genome Map
Score = 43.0 bits (22), Expect = 2e-04
Identities = 29/30 (96%), Gaps = 1/30 (3%)
Strand = Plus / Plus
Query: 9 gctgcataaaaacggcataaattcaattga 38
|||||||||||||| |||||||||||||||
Sbjct: 187 gctgcataaaaacg-cataaattcaattga 215
>CG6667-RB type=mRNA;
loc= 2L:complement (17414916..17415406,17415502..17416100,
17416233..17416295,17417273..17417380,
17419884..17419962,17420023..17420417,
17420487..17420665,17420735..17421088,
17427379..17427451,17427959..17428442); ID=dl-RB;
name=dl-RB; db_xref='CG6667,FlyBase:FBgn0000462';
len=2825
Length = 2825
Genome Map
Score = 43.0 bits (22), Expect = 2e-04
Identities = 29/30 (96%), Gaps = 1/30 (3%)
Strand = Plus / Plus
Query: 9 gctgcataaaaacggcataaattcaattga 38
|||||||||||||| |||||||||||||||
Sbjct: 187 gctgcataaaaacg-cataaattcaattga 215
\#
anon- EST:Nelson1  = CG4065
>anon- EST:Nelson1 
ggcangaggc gaaccagaga angggtctga cnctcccaat cccatgggtt tctctccgcg
catccacgac cgcagccnac cgcccgcgtt tccgcgtacc attaagatca gggatcgtcc
atccngttat cnatttctag aggaaatgat ttcgngcttc aaatacncct gcaaagtcnc
cnnntacaag gattactant cggcgctgaa cttctttatc gantacagca aaaagtnggg
ccactgcatc ctgtccagaa gcgtgctgca aaccctgttc agcgcccaca tgngttatgg
cgcacngtaa agcttcccat naaagcantt ccngcgccat cggttcaggt cttcaactcn
ccacccgtat tgaatgccaa ncacccngtg gctgcccatc ccaacgtgc
Database: dmel_all_transcript_r320
>CG4065-RA type=mRNA;
loc= 2R:complement (19178741..19178935,19178998..19180035,
19180094..19180275,19180336..19180903,19180967..19181339,
19181429..19181606); ID=CG4065-RA; name=CG4065-RA;
db_xref='CG4065,FlyBase:FBgn0034982'; len=2534
Length = 2534
Genome Map
Score = 581 bits (302), Expect = e-165
Identities = 366/399 (91%), Gaps = 4/399 (1%)
Strand = Plus / Plus
Query: 12 aaccagagaangggtctgacnctcccaatcccatgggtttctctccgcgcatccacgacc 71
|||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 1105 aaccagagaaggggtctgacgctcccaatcccatgggtttctctccgcgcatccacgacc 1164
Query: 72 gcagccnaccgcccgcgtttccgcgtaccattaagatcagggatcgtccatccngttatc 131
|||||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||||
Sbjct: 1165 gcagccaaccgcccgcgtttccgcgtagcattaagatcagggatcgtccatccagttatc 1224
Query: 132 natttctagaggaaatgatttcgngcttcaaatacncctgcaaagtcnccnnntacaagg 191
||||||||||||||||||||| ||||||||||| ||||||||||| || |||||||
Sbjct: 1225 agtttctagaggaaatgatttcgcgcttcaaatacgcctgcaaagtcaccaagtacaagg 1284
Query: 192 attactantcggcgctgaacttctttatcgantacagcaaaaagtngggccactgcatcc 251
||||||| ||||||||||||||||||||||| ||||||||||||| |||||| |||||||
Sbjct: 1285 attactattcggcgctgaacttctttatcgagtacagcaaaaagtcgggccagtgcatcc 1344
Query: 252 tgtccagaagcgtgctgcaaaccctgttcagcgcccacatgngttatggcgcacngtaaa 311
||||||||||||||||||||||||||||||||||| ||||| | |||||||||| | |||
Sbjct: 1345 tgtccagaagcgtgctgcaaaccctgttcagcgccaacatgcg-tatggcgcacgg-aaa 1402
Query: 312 gcttcccatnaaagcanttccngcgcca-tcggttcaggtcttcaactcnccacccgtat 370
||||||||| ||||| |||| |||||| |||||||||||||||||||| ||||||||||
Sbjct: 1403 gcttcccatg-aagcagttcctgcgccactcggttcaggtcttcaactcgccacccgtat 1461
Query: 371 tgaatgccaancacccngtggctgcccatcccaacgtgc 409
|||||||||| || || ||||||||| ||||||| ||||
Sbjct: 1462 tgaatgccaagcatccggtggctgccgatcccaaggtgc 1500
\#
anon- EST:ParkEST125  = CG4182
>anon- EST:ParkEST125 
gaattctgac caactgaccg gaggtccaca aaaaaaatag cgagcaatcc aaaaaaatcg
aacaattaaa acccatagct ccaaaatgaa cccactagga atgttgagcc tgggcttaat
ggtgtgcctt atcggcgcct tcagccggat tgcatcggcc aagctggagg agaagttctc
gtggaagcaa ctggccttcg attggcccac tccggaggcc gaggcggagg ccaagtcgaa
tggccactac atcgtggaga acaacctgcc gctggtcgtg gagcgttggc aaaacagaat
ctttgtcact gtgccaagat ggaaggctgg tgttgctgcc acactcaact acatcgacat
caattcgacg gagaagtcgc caaagctgca tccgtatccc agttgggagg ccaacaagtt
gccgcgcggc cgc
Database: dmel_all_transcript_r320
>CG4182-c-RA type=mRNA;
loc= 2L:join (15013556..15013881,15014671..15015076,
15015136..15015927); ID=yellow-c-RA; name=yellow-c-RA;
db_xref='CG4182,FlyBase:FBgn0041713'; len=1524
Length = 1524
Genome Map
Score = 644 bits (335), Expect = 0.0
Identities = 341/344 (99%)
Strand = Plus / Plus
Query: 80 tccaaaatgaacccactaggaatgttgagcctgggcttaatggtgtgccttatcggcgcc 139
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 88 tccaaaatgaacccactaggaatgttgagcctgggcttaatggtgtgccttatcggcgcc 147
Query: 140 ttcagccggattgcatcggccaagctggaggagaagttctcgtggaagcaactggccttc 199
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148 ttcagccggattgcatcggccaagctggaggagaagttctcgtggaagcaactggccttc 207
Query: 200 gattggcccactccggaggccgaggcggaggccaagtcgaatggccactacatcgtggag 259
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 208 gattggcccactccggaggccgaggcggaggccaagtcgaatggccactacatcgtggag 267
Query: 260 aacaacctgccgctggtcgtggagcgttggcaaaacagaatctttgtcactgtgccaaga 319
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 268 aacaacctgccgctgggcgtggagcgttggcaaaacagaatctttgtcactgtgccaaga 327
Query: 320 tggaaggctggtgttgctgccacactcaactacatcgacatcaattcgacggagaagtcg 379
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 328 tggaaggctggtgttgctgccacactcaactacatcgacattaattcgacggagaagtcg 387
Query: 380 ccaaagctgcatccgtatcccagttgggaggccaacaagttgcc 423
||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 388 ccaaagctgcatccgtatcccagttgggaggccaacaagctgcc 431
\#
anon- EST:ParkEST132  = CG10992
>anon- EST:ParkEST132 
gaattctgac taactgacaa cgtcagtcgc gaatcggaat gaaaataaaa ggaggggagt
acgaaaacaa gaacggagca gagagcccgc ttaatatgac gcgtcatttt ccaccatttt
actgctgtga tttgtttgaa ttttgctgtg tcagcgcact ggaaattcgt tggacaagaa
taatgaaact actgctcctg gtggccaccg cggcctccgt ggcggcactc acgtccggtg
agccgtcact gctctcggat gagttcatcg aggtggtgcg cagtaaggcc aaaacctgga
cggtgggtcg caatttcgat gcatccgtaa cggagccgcg cggccgc
Database: dmel_all_transcript_r320
>CG10992-RA type=mRNA;
loc= X:complement (13510677..13511309,13511818..13511985,
13512132..13512392,13512469..13512840); ID=CG10992-RA;
name=CG10992-RA; db_xref='CG10992,FlyBase:FBgn0030521';
len=1434
Length = 1434
Genome Map
Score = 514 bits (267), Expect = e-145
Identities = 277/282 (98%)
Strand = Plus / Plus
Query: 54 ggggagtacgaaaacaagaacggagcagagagcccgcttaatatgacgcgtcattttcca 113
||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 124 gggcagtacgaaaacaagaacggagcagagagcccgcttaatacgacgcgtcattttcca 183
Query: 114 ccattttactgctgtgatttgtttgaattttgctgtgtcagcgcactggaaattcgttgg 173
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 184 ccattttactgctgtgatttgtttgaattttgctgtgtcagcgcattggaaattcgttgg 243
Query: 174 acaagaataatgaaactactgctcctggtggccaccgcggcctccgtggcggcactcacg 233
|||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 244 acaagaataatgaatctattgctcctggtggccaccgcggcctccgtggcggcactcacg 303
Query: 234 tccggtgagccgtcactgctctcggatgagttcatcgaggtggtgcgcagtaaggccaaa 293
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 304 tccggtgagccgtcactgctctcggatgagttcatcgaggtggtgcgcagtaaggccaaa 363
Query: 294 acctggacggtgggtcgcaatttcgatgcatccgtaacggag 335
||||||||||||||||||||||||||||||||||||||||||
Sbjct: 364 acctggacggtgggtcgcaatttcgatgcatccgtaacggag 405
Score = 68.0 bits (35), Expect = 5e-11
Identities = 37/38 (97%)
Strand = Plus / Minus
Query: 19 aacgtcagtcgcgaatcggaatgaaaataaaaggaggg 56
||||||||| ||||||||||||||||||||||||||||
Sbjct: 1371 aacgtcagttgcgaatcggaatgaaaataaaaggaggg 1334
\#
anon- EST:ParkEST325  = CG6199
>anon- EST:ParkEST325 
gaattctgac taactgacgg ggggggggtc gcagagaagg ctgttcatcc ggccgataac
gcaccatgaa gttcatcagc gcgcgtggag gattgtggaa gtaacccgta aaggcgcgct
cttgcgggtg ggactcccga tattttgtgg agcggaaggt gttttgattt ccttagcatt
tagcacaaaa aaatgcaact agtataaagt actgttcact ataacaattt ttaaccaccg
atagcgagtg cttcactgtg tgtgcgagta agagagagag agagcaacta gctccagcat
catgagaata caacaaagcg ccttgttgtt gttgctgctg gccgtgacgt cgcaaggaga
tgccgagtcc ccgcgcggcc gc
Database: dmel_all_transcript_r320
>CG6199-RA type=mRNA;
loc= 3L:complement (11155698..11156242,11156302..11156736,
11156798..11156924,11159747..11159872,
11159932..11160033,11160154..11160407,
11160475..11161006,11161065..11161204,
11162437..11162522,11163266..11163578); ID=CG6199-RA;
name=CG6199-RA; db_xref='CG6199,FlyBase:FBgn0036147';
len=2660
Length = 2660
Genome Map
Score = 402 bits (209), Expect = e-111
Identities = 230/251 (91%)
Strand = Plus / Plus
Query: 120 tcttgcgggtgggactcccgatattttgtggagcggaaggtgttttgatttccttagcat 179
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 53 tcttgcgggtgggactcccgatattttgtggagcggaaggtgttttgatttccttagcat 112
Query: 180 ttagcacnnnnnnntgcaactagtataaagtactgttcactataacaatttttaaccacc 239
||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 113 ttagcacaaaaaaatgcaactagtataaagtactgttcactataacaatttttaaccacc 172
Query: 240 gatagcgagtgcttcactgtgtgtgcgagtannnnnnnnnnnnnncaactagctccagca 299
||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 173 gatagcgagtgcttcactgtgtgtgcgagtaagagagagagagagcaactagctccagca 232
Query: 300 tcatgagaatacaacaaagcgccttgttgttgttgctgctggccgtgacgtcgcaaggag 359
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 233 tcatgagaatacaacaaagcgccttgttgttgttgctgctggccgtgacgtcgcaaggag 292
Query: 360 atgccgagtcc 370
|||||||||||
Sbjct: 293 atgccgagtcc 303
Score = 181 bits (94), Expect = 4e-45
Identities = 96/97 (98%)
Strand = Plus / Minus
Query: 29 tcgcagagaaggctgttcatccggccgataacgcaccatgaagttcatcagcgcgcgtgg 88
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2178 tcgcagagaaggctgttcatccggccgataacgcaccatgaagttcatcagcgcgcgtgg 2119
Query: 89 aggattgtggaagtaacccgtaaaggcgcgctcttgc 125
||||||||||||||||||||||||||||||||| |||
Sbjct: 2118 aggattgtggaagtaacccgtaaaggcgcgctcctgc 2082
\#
\------
Date: Thu, 1 Jul 2004  09:56:05  \+0100 (BST)
From: 'Michael Ashburner (Genetics)' <ma11@XXXX>
Subject: Death to anon-ESTs 3
To: crosbyXXXX, ma11XXXX, gm119@XXXX
Cc: gm119@XXXX
Here is the last bunch of anon-ESTs, algorithm as before. enjoy
M
anon- EST:Posey1  = new ?
anon- EST:Posey101  = CG32172
anon- EST:Posey102  = CG3056
anon- EST:Posey107  = new ?
anon- EST:Posey11  = CG8086?
anon- EST:Posey117  = CG3257
anon- EST:Posey119  = ? end of MTA-like ?
anon- EST:Posey126  = ? end of Df31 ?
anon- EST:Posey139  = end of  BEST:GH08269  ?
anon- EST:Posey146  = new?
anon- EST:Posey152  = ?
anon- EST:Posey155  = ?
anon- EST:Posey156  = EST GM16138
anon- EST:Posey171  = CG12187
anon- EST:Posey175  = end of CG13203 ?
anon- EST:Posey178  = ? end CG31369 ?
anon- EST:Posey186  = CG6549
anon- EST:Posey204  = CG10071
anon- EST:Posey215  = CG2985?
anon- EST:Posey216  = end of CG32423
anon- EST:Posey221  = CG3620
anon- EST:Posey226  = end of CG32712 ?
anon- EST:Posey232  = CG18815
anon- EST:Posey243  = CG32172
anon- EST:Posey246  = CG5627
anon- EST:Posey247  = CG5119
anon- EST:Posey249  = CG5119
anon- EST:Posey25  = CG30185
anon- EST:Posey251  = ?
anon- EST:Posey259  =CG8177
anon- EST:Posey262  = CG15209
anon- EST:Posey263  = ? end of l(3)82Fd ?
anon- EST:Posey264  = not in genome, and a pretty odd seq
anon- EST:Posey268  = ?
anon- EST:Posey277  = CG31451
anon- EST:Posey280  = ?
anon- EST:Posey285  = CG6869
anon- EST:Posey288  = CG13993
anon- EST:Posey289  = end of lace ?
anon- EST:Posey292  = CG32172
anon- EST:Posey294  = CG2848
anon- EST:Posey35  = CG32172
anon- EST:Posey37  = CG9282
anon- EST:Posey5  = CG1263
anon- EST:Posey52  = CG31158?
anon- EST:Posey55  = CG11739
anon- EST:Posey59  = CG8472
anon- EST:Posey6  = CG6253
anon- EST:Posey64  = CG11593
anon- EST:Posey65  = CG16982
anon- EST:Posey67  = CG8309
anon- EST:Posey69  = CG31543
anon- EST:Posey7  = end of CHES-1-like ?
anon- EST:Posey79  = CG5889
anon- EST:Posey83  = ?
anon- EST:Posey9  = CG9325
anon- EST:Posey93  = end of dlg1 ?
anon- EST:PoseyA1  = qbert
anon- EST:CL1d7  = CG10391
anon- EST:CLB3  = CG6736
\#
anon- EST:Posey1  = new ?
>anon- EST:Posey1 
ggcacgagcc aaagttcact tgtctcagat tttaacttaa tttggagctt tatacagtat
acagaagatt ttatttcacc acctatcata attcaaatta aaattgtttt tgaaatagta
aagcggtaaa ttaaaaacta tatgtctatg aaaatctgtc tataaaaata tgtataattt
gattaaatta atttttcatt tgtaagaatt actataatta tttaaaattt aaaaactctt
gtacggcttt ttgactcaaa atctttgctt acaaaaaaga tttgtccccg cataagtcaa
cacggtgttg acatggtgtt ctcatggtac tcaaaaataa ttaagtatgt atcaaagtat
tagtgcgaaa aaatgtgaaa tagaaagtta acattttagc atataggaat acaactatta
aaatgaattt aaatgtttga atttgttaca aaataaagtt aatttataaa cagcaaaaa
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE002665 |gb|AE002665| arm:3L  23206183..23352213
estimated- cyto:80E3-80F6  gadfly- seqname:AE002665 
 seq_release:3 
Length = 146031
Score = 896 bits (466), Expect = 0.0 Genome Map
Identities = 468/469 (99%)
Strand = Plus / Minus
Query: 9 ccaaagttcacttgtctcagattttaacttaatttggagctttatacagtatacagaaga 68
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24285 ccaaagttcacttgtctcagattttaacttaatttggagctttatacagtatacagaaga 24226
Query: 69 ttttatttcaccacctatcataattcaaattaaaattgtttttgaaatagtaaagcggta 128
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24225 ttttatttcaccacctatcataattcaaattaaaattgtttttgaaatagtaaagcggta 24166
Query: 129 aattaaaaactatatgtctatgaaaatctgtctataaaaatatgtataatttgattaaat 188
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24165 aattaaaaactatatgtctatgaaaatctgtctataaaaatatgtataatttgattaaat 24106
Query: 189 taatttttcatttgtaagaattactataattatttaaaatttaaaaactcttgtacggct 248
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24105 taatttttcatttgtaagaattactataattatttaaaatttaaaaactcttgtacggct 24046
Query: 249 ttttgactcaaaatctttgcttacaaaaaagatttgtccccgcataagtcaacacggtgt 308
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24045 ttttgactcaaaatctttgcttacaaaaaagatttgtccccgcataagtcaacacggtgt 23986
Query: 309 tgacatggtgttctcatggtactcaaaaataattaagtatgtatcaaagtattagtgcga 368
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 23985 tgacatggtgttctcatggtactcaaaaataattaagtatgtatcaaagtattagtgcga 23926
Query: 369 aaaaatgtgaaatagaaagttaacattttagcatataggaatacaactattaaaatgaat 428
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 23925 aaaaatgtgaaatagaaagttaacattttagcatataggaatacaactattaaaatgaat 23866
Query: 429 ttaaatgtttgaatttgttacaaaataaagttaatttataaacagcaaa 477
|||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 23865 ttaaatgtatgaatttgttacaaaataaagttaatttataaacagcaaa 23817
>gadfly| SEG:AE003507 |gb|AE003507| arm:X  17583607..17883410
estimated- cyto:16E1-16F7  gadfly- seqname:AE003507 
 seq_release:3 
Length = 299804
Score = 43.0 bits (22), Expect = 0.007 Genome Map
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 170 atgtataatttgattaaattaattt 194
||||||||||| |||||||||||||
Sbjct: 87125 atgtataatttaattaaattaattt 87149
\#
anon- EST:Posey101  = CG32172
>anon- EST:Posey101 
ggcacgagcc gcagcaacga cggttgggca catcccgtct catccccact ctctcgaatt
gtgtccgttg gtagccgaag ttacgattgc aaaactttcg tcatctctct ctcactctct
gaagcaaaag ccaaggccgg agcaggtgca tatggtgcca acccccctgg cccccccaaa
aggggggtgg tgctggtgca attgcaaagg cacaggagca caggagcagc taaataaaca
agaaagcaaa atcaacaacc gcaaaagtct aagacatgta tcacgaattg aaaatgataa
tgacaaaaaa aaa
Database: dmel_all_transcript_r320
>CG32172-RA type=mRNA; loc= 3L:complement (17348426..17350337); Genome Map
ID=noe-RA; name=noe-RA;
db_xref='CG32172,FlyBase:FBgn0026197'; len=1912
Length = 1912
Score = 442 bits (230), Expect = e-124
Identities = 263/296 (88%)
Strand = Plus / Plus
Query: 9 ccgcagcaacgacggttgggcacatcccgtctcatccccactctctcgaattgtgtccgt 68
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 126 ccgcagcaacgacggttgggcacatcccgtctcatccccactctctcgaattgtgtccgt 185
Query: 69 tggtagccgaagttacgattgcaaaactttcgtcannnnnnnnnnnnnnnnngaagcaaa 128
||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 186 tggtagccgaagttacgattgcaaaactttcgtcatctctctctcactctctgaagcaaa 245
Query: 129 agccaaggccggagcaggtgcatatggtgccaannnnnnnnnnnnnnnnaaaaggggggt 188
||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 246 agccaaggccggagcaggtgcatatggtgccaacccccctggcccccccaaaaggggggt 305
Query: 189 ggtgctggtgcaattgcaaaggcacaggagcacaggagcagctaaataaacaagaaagca 248
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 306 ggtgctggtgcaattgcaaaggcacaggagcacaggagcagctaaataaacaagaaagca 365
Query: 249 aaatcaacaaccgcaaaagtctaagacatgtatcacgaattgaaaatgataatgac 304
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 366 aaatcaacaaccgcaaaagtctaagacatgtatcacgaattgaaaatgataatgac 421
\#
anon- EST:Posey102  = CG3056
>anon- EST:Posey102 
ggcacgagat aaacttgaaa ttttccaacc agcatacccg tgagacccag aggtccgaaa
tttttttttt tagtattgat aatctctaaa cgtaaatcct agtctcgtag caatatcata
gttaaggtga cttttttttc agaataaact taaagcacga aagaaataca tgtatttaaa
ccttaaatcc taaagtttat aataaacgaa cacaaattga attcttgagt ctgcgagcga
gatggtgcga tgcagcctca gcgaaagaga gcgagagaga tgatacagat ttgaggtaca
gtcagcacag tacagtgcgg atcagagctt aagttgacga tatactattg ttgtaaattg
atgttaggct aagcaaataa atagttaaaa tgttcaaaaa
Database: dmel_all_transcript_r320
>CG3056-RA type=mRNA;
loc= X:join (1128003..1128100,1128668..1128807,
1128888..1129211,1129352..1129459,1129523..1129704,
1129898..1130484,1130595..1132177); ID=CG3056-RA;
name=CG3056-RA; db_xref='CG3056,FlyBase:FBgn0024987';
len=3022
Length = 3022
Genome Map
Score = 319 bits (166), Expect = 8e-87
Identities = 192/212 (90%), Gaps = 1/212 (0%)
Strand = Plus / Plus
Query: 9 ataaacttgaaattttccaaccagcatacccgtgagacccagaggtccgaaannnnnnnn 68
||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2811 ataaacttgaaattttccaaccagcatacccgtgagacccagaggtccgaaatttttttt 2870
Query: 69 nnn-agtattgataatctctaaacgtaaatcctagtctcgtagcaatatcatagttaagg 127
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2871 ttttagtattgataatctctaaacgtaaatcctagtctcgtagcaatatcatagttaagg 2930
Query: 128 tgacnnnnnnnncagaataaacttaaagcacgaaagaaatacatgtatttaaaccttaaa 187
|||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2931 tgacttttttttcagaataaacttaaagcacgaaagaaatacatgtatttaaaccttaaa 2990
Query: 188 tcctaaagtttataataaacgaacacaaattg 219
||||||||||||||||||||||||||||||||
Sbjct: 2991 tcctaaagtttataataaacgaacacaaattg 3022
>CG3056-RB type=mRNA;
loc= X:join (1128003..1128100,1128668..1128807,
1128888..1129211,1129352..1129459,1129523..1129704,
1129898..1132120); ID=CG3056-RB; name=CG3056-RB;
db_xref='CG3056,FlyBase:FBgn0024987'; len=3075
Length = 3075
Genome Map
Score = 210 bits (109), Expect = 8e-54
Identities = 135/155 (87%), Gaps = 1/155 (0%)
Strand = Plus / Plus
Query: 9 ataaacttgaaattttccaaccagcatacccgtgagacccagaggtccgaaannnnnnnn 68
||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2921 ataaacttgaaattttccaaccagcatacccgtgagacccagaggtccgaaatttttttt 2980
Query: 69 nnn-agtattgataatctctaaacgtaaatcctagtctcgtagcaatatcatagttaagg 127
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2981 ttttagtattgataatctctaaacgtaaatcctagtctcgtagcaatatcatagttaagg 3040
Query: 128 tgacnnnnnnnncagaataaacttaaagcacgaaa 162
|||| |||||||||||||||||||||||
Sbjct: 3041 tgacttttttttcagaataaacttaaagcacgaaa 3075
\#
anon- EST:Posey107  = new ?
>anon- EST:Posey107 
ggcacgagaa agatccatgt tgcatcctcg gcagttgtgt gttgtttatg ccgagaattg
gagcgcatcg acaagttaca gcaaatgttg catcatattg ttgccctgct gcctgttgtg
ctggcaaatg aagtggaaat tgagtctgct cttgttgact gcggttgcat ttcctttttt
tttttttttt
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003636 |gb|AE003636| arm:2L  12386446..12632675
estimated- cyto:33E3-33F2  gadfly- seqname:AE003636 
 seq_release:3 
Length = 246230
Score = 302 bits (157), Expect = 2e-81 Genome Map
Identities = 159/160 (99%)
Strand = Plus / Minus
Query: 14 tccatgttgcatcctcggcagttgtgtgttgtttatgccgagaattggagcgcatcgaca 73
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 120382 tccatgttgcatcctcggcagttgtgtgttgtttatgccgagaattggagcgcatcgaca
120323
Query: 74 agttacagcaaatgttgcatcatattgttgccctgctgcctgttgtgctggcaaatgaag 133
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 120322 agttgcagcaaatgttgcatcatattgttgccctgctgcctgttgtgctggcaaatgaag
120263
Query: 134 tggaaattgagtctgctcttgttgactgcggttgcatttc 173
||||||||||||||||||||||||||||||||||||||||
Sbjct: 120262 tggaaattgagtctgctcttgttgactgcggttgcatttc 120223
\#
anon- EST:Posey11  = CG8086?
>anon- EST:Posey11 
ggcacgaggg tatctgtatc tctgacatga tcaacaatca tctcaactca gtgaaaacgt
ttttatgttc tttcgacttc atttcacgct ctccaaaact gcgaattaaa tatgagctca
ttcccaaaat ttagacaatt tccaggcggc caacttgggg gcttttacgc ccaaatacgg
cggccgacgt ttcctttagc ccacattgag ttgtccgaaa aagccagttc ggaattgggt
ttccagacgg cagatcgacc cacgcagaaa ctccatgact ccgcgatata tagacataca
gccaaatagc cataattcgt gtgctgtctc tattaactat tgcctctttt tttttgtaaa
agtttaatta acgccgaaca agttgagcaa ttcctttcca aaaacagaaa acgacaacaa
gtgagtgagc cagccggcaa aaggccaaag gccgaaaaga gctggtaaat gaaaacatga
gagccaagaa gcaaaactga actctcgtga ttgtgataaa aacgccaaga ccgactgacg
tcagctgtgt gaactagttt gcgatcgtcc aaatctaatt aagtttctca acattctcgg
tgctctgcag cgcgaacgtg ttttggcttt gaaaaccaag agaaagctgg gaaatgaggc
gggaaaaatt ggcaaaccct cactgaaact tggttctcaa ggcacaaggc caatgttttc
aaatagctgt tgataattac taaatttaat gggggaccat cacacatccg tttccaaatt
ctagagcctg agatcactgg ctgctgctga cacaatttgc atgtttggat acataaatat
ccgtttgggt cattttataa atatttattt agcgattatt gcatttcccc ttagcagctt
atttttctat ttaacctttt accattcgtt actttgttat tttgtatctt tttttttttt
tttgtttttg gccaacgcgc ttttgtgttg tgcctgcgcc ataatcagtg actttgaaaa
atgagctgct gactcgggtc gaccggttat tagagctgat gtcatgggct tcgtgggaca
agtgaagtaa aggtatcaag aaccgcggaa gggttacatc tatgccaaca agtgacatca
atacgggaac gcgattgtca ttgactaaac aatgggagga gctgggtgga tttatttggg
ggcggagcag aacagctgac tggcggtggg gaaacctagc cctatgccac caggaaatgc
caatagttag acagacagac agtcaatgaa ctttggggtc gggtcagcac gcaatcccac
tggctgctcc ggtcgggctc cacctgactt ggttaacgcc tactccagtt tatccttacc
gcaggctact ttacgatttc gggtatctcg tcctgtttcc gttgtatcgt gtgatttccg
taactttctt ttacacagta aaaaacttca ctttattgcg gtgctaatag cgcgtagtgc
atacagtcct tgccaggatt agtcgcgatt tttgggcgat attcaaaaca tctgttcacc
cgaaagagat tgctatattc gttgttattg tagttgggtt tcgtggctga tttattattt
cgttgattcg ttcgttgatt gggttcaagt gacagccgct ttcgagtgtc ggtctgccga
ctggcgtttg aagtctacta gaggttttca aaacaaaaca cactttgctg atttatttat
accgattgga ttggccgcta tgagctgagt ttgtttcagt gaaagagaag agagctagct
agaaccgca
Database: dmel_all_transcript_r320
>CG8086-RA type=mRNA;
loc= 2L:complement (8236776..8236963,8237201..8237454,
8244459..8244764,8244826..8245006,8249309..8249733);
ID=CG8086-RA; name=CG8086-RA;
db_xref='CG8086,FlyBase:FBgn0032010'; len=1354
Length = 1354
Genome Map
Score = 821 bits (427), Expect = 0.0
Identities = 427/427 (100%)
Strand = Plus / Minus
Query: 1378 accgcaggctactttacgatttcgggtatctcgtcctgtttccgttgtatcgtgtgattt 1437
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 427 accgcaggctactttacgatttcgggtatctcgtcctgtttccgttgtatcgtgtgattt 368
Query: 1438 ccgtaactttcttttacacagtaaaaaacttcactttattgcggtgctaatagcgcgtag 1497
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 367 ccgtaactttcttttacacagtaaaaaacttcactttattgcggtgctaatagcgcgtag 308
Query: 1498 tgcatacagtccttgccaggattagtcgcgatttttgggcgatattcaaaacatctgttc 1557
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 307 tgcatacagtccttgccaggattagtcgcgatttttgggcgatattcaaaacatctgttc 248
Query: 1558 acccgaaagagattgctatattcgttgttattgtagttgggtttcgtggctgatttatta 1617
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 247 acccgaaagagattgctatattcgttgttattgtagttgggtttcgtggctgatttatta 188
Query: 1618 tttcgttgattcgttcgttgattgggttcaagtgacagccgctttcgagtgtcggtctgc 1677
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 187 tttcgttgattcgttcgttgattgggttcaagtgacagccgctttcgagtgtcggtctgc 128
Query: 1678 cgactggcgtttgaagtctactagaggttttcaaaacaaaacacactttgctgatttatt 1737
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 127 cgactggcgtttgaagtctactagaggttttcaaaacaaaacacactttgctgatttatt 68
Query: 1738 tataccgattggattggccgctatgagctgagtttgtttcagtgaaagagaagagagcta 1797
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 67 tataccgattggattggccgctatgagctgagtttgtttcagtgaaagagaagagagcta 8
Query: 1798 gctagaa 1804
|||||||
Sbjct: 7 gctagaa 1
\#
anon- EST:Posey117  = CG3257
>anon- EST:Posey117 
ggcacgagcg gcacttttgt gccattttac acccaaatcg atggtgtttt ttttggggaa
aacttaaaac caagttagct ccatcgaaat ggcgatacga acctagttac tcgaacaaac
gaatatgcaa acttagtctg aaggtcaatt ggtcctcatt tagagtcgtt gaatgttcat
tacttgcttt ccgtgtgcgt tgacgacatt taccgaagat ggatctggtt tcactggaca
aatccactcc gattagcact cgaaaatcga aagatagtga agcaaaaccg actaagtctg
ttagctgtta gatggaagta ggaaattaca aataaaacgc gtaggaaaag cgaatcgata
ccaagtactt tttccaagta gctaagtagc tgagtaagag aggagcccga actcgcatca
gcatagaaat aattcgaaag ggatcgtagg aagtgtaagg attgtatttc gggctctggg
aggttttcaa agtcggactc ctgtgcttga aaaacatata taaatgtacg aatatactaa
acacctcaaa aaa
Database: dmel_all_transcript_r320
>CG3257-RA type=mRNA;
loc= 2R:join (19160357..19160540,19163153..19163174,
19163464..19163822,19164280..19164389,19164460..19165042,
19165101..19165402,19165478..19166838); ID=CG3257-RA;
name=CG3257-RA; db_xref='CG3257,FlyBase:FBgn0034978';
len=2921
Length = 2921
Genome Map
Score = 983 bits (511), Expect = 0.0
Identities = 530/541 (97%), Gaps = 1/541 (0%)
Strand = Plus / Plus
Query: 9 cggcacttttgtgccattttacacccaaatcgatggtgnnnnnnnn-ggggaaaacttaa 67
|||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 2375 cggcacttttgtgccattttacacccaaatcgatggtgtttttttttggggaaaacttaa 2434
Query: 68 aaccaagttagctccatcgaaatggcgatacgaacctagttactcgaacaaacgaatatg 127
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2435 aaccaagttagctccatcgaaatggcgatacgaacctagttactcgaacaaacgaatatg 2494
Query: 128 caaacttagtctgaaggtcaattggtcctcatttagagtcgttgaatgttcattacttgc 187
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2495 caaacttagtctgaaggtcaattggtcctcatttagagtcgttgaatgttcattacttgc 2554
Query: 188 tttccgtgtgcgttgacgacatttaccgaagatggatctggtttcactggacaaatccac 247
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2555 tttccgtgtacgttgacgacatttaccgaagatggatctggtttcactggacaaatccac 2614
Query: 248 tccgattagcactcgaaaatcgaaagatagtgaagcaaaaccgactaagtctgttagctg 307
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2615 tccgattagcactcgaaaatcgaaagatagtgaagcaaaaccgactaagtctgttagctg 2674
Query: 308 ttagatggaagtaggaaattacaaataaaacgcgtaggaaaagcgaatcgataccaagta 367
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 2675 ttagatggaagtaggaaattacaagtaaaacgcgtaggaaaagcgaatcgataccaagta 2734
Query: 368 ctttttccaagtagctaagtagctgagtaagagaggagcccgaactcgcatcagcataga 427
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2735 ctttttccaagtagctaagtagctgagtaagagaggagcccgaactcgcatcagcataga 2794
Query: 428 aataattcgaaagggatcgtaggaagtgtaaggattgtatttcgggctctgggaggtttt 487
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2795 aataattcgaaagggatcgtaggaagtgtaaggattgtatttcgggctctgggaggtttt 2854
Query: 488 caaagtcggactcctgtgcttgaaaaacatatataaatgtacgaatatactaaacacctc 547
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2855 caaagtcggactcctgtgcttgaaaaacatatataaatgtacgaatatactaaacacctc 2914
Query: 548 a 548
|
Sbjct: 2915 a 2915
\#
anon- EST:Posey119  = ? end of MTA-like ?
>anon- EST:Posey119 
ggcacgagaa acaaactaac agagagacaa gcaacagaag caaatcaaac agagctatat
acataattat atacctatat atatatatta tatacagata tacagtataa cagtacatac
atggcgcatt ggtcaagaac agtacgcata atccttttta cagagcaaga aactgacgaa
gacgacgacg tgacggccag acaagcaacc gaaaaagttt tccaaataaa attttaaaac
taaacatttt tcctaaaaa
Database: dmel_all_scaffolds_r310
gadfly| SEG:AE003602 |gb|AE003602| arm:3R  1266332..1562422
estimated- cyto:83A3-83C1  gadfly- seqname:AE003602 
 seq_release:3 
Length = 296091
Score = 289 bits (150), Expect = 3e-77 Genome Map
Identities = 150/150 (100%)
Strand = Plus / Minus
Query: 110 acagtacatacatggcgcattggtcaagaacagtacgcataatcctttttacagagcaag 169
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 198187 acagtacatacatggcgcattggtcaagaacagtacgcataatcctttttacagagcaag
198128
Query: 170 aaactgacgaagacgacgacgtgacggccagacaagcaaccgaaaaagttttccaaataa 229
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 198127 aaactgacgaagacgacgacgtgacggccagacaagcaaccgaaaaagttttccaaataa
198068
Query: 230 aattttaaaactaaacatttttcctaaaaa 259
||||||||||||||||||||||||||||||
Sbjct: 198067 aattttaaaactaaacatttttcctaaaaa 198038
Score = 91.1 bits (47), Expect = 1e-17 Genome Map
Identities = 47/47 (100%)
Strand = Plus / Minus
Query: 9 aaacaaactaacagagagacaagcaacagaagcaaatcaaacagagc 55
|||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 198288 aaacaaactaacagagagacaagcaacagaagcaaatcaaacagagc 198242
Score = 37.2 bits (19), Expect = 0.19 Genome Map
Identities = 27/31 (87%)
Strand = Plus / Minus
Query: 218 ttttccaaataaaattttaaaactaaacatt 248
||||| ||||| |||| |||||||||||||
Sbjct: 219884 ttttcttaataatatttaaaaactaaacatt 219854
\#
anon- EST:Posey126  = ? end of Df31 ?
>anon- EST:Posey126 
ggcacgaggt tttttttttt ttaaaatgct ttcgaaatcg tacctttttt atttgtaatc
aaggtaccac ctatttcaca ttcccaatta cattttattt acttgtctaa gcctacgaaa
tagtctgcga cgaaactctc attaatgttc aatgtttaac aacgatttaa tgggcaggaa
aggtaatggc cagtaaatcc agcattcagc aaaatcaaga ttcgagatta ttaaaaaata
aaatgaaacg taaaaattaa aatcaaaaa
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003781 |gb|AE003781| arm:2L  21394058..21699819
estimated- cyto:39E1-40B1  gadfly- seqname:AE003781 
 seq_release:3 
Length = 305762
Score = 402 bits (209), Expect = e-111 Genome Map
Identities = 209/209 (100%)
Strand = Plus / Minus
Query: 23 aaaatgctttcgaaatcgtaccttttttatttgtaatcaaggtaccacctatttcacatt 82
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 65900 aaaatgctttcgaaatcgtaccttttttatttgtaatcaaggtaccacctatttcacatt 65841
Query: 83 cccaattacattttatttacttgtctaagcctacgaaatagtctgcgacgaaactctcat 142
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 65840 cccaattacattttatttacttgtctaagcctacgaaatagtctgcgacgaaactctcat 65781
Query: 143 taatgttcaatgtttaacaacgatttaatgggcaggaaaggtaatggccagtaaatccag 202
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 65780 taatgttcaatgtttaacaacgatttaatgggcaggaaaggtaatggccagtaaatccag 65721
Query: 203 cattcagcaaaatcaagattcgagattat 231
|||||||||||||||||||||||||||||
Sbjct: 65720 cattcagcaaaatcaagattcgagattat 65692
\#
anon- EST:Posey139  = end of  BEST:GH08269  ?
>anon- EST:Posey139 
ggcacgaggg agcaaggaga tttggcggag gagccgataa caacaataat gaaattaatg
gagtaaacca attaaatcca tggaattccc aaatctaaaa taaaagctaa cttaatacgt
ttttatttga atgaaagagt aacaaatcga ttgtaatatt gtatttcttg tgggcgtaaa
acatcgacaa acgctcgacc cgttttacta gcatttaaaa caactattat ttaagagcat
tttaaacatg aaaaaagaaa ataaaatcgg cagctacgcg cttctatcaa aagcacaatt
gtaaaaagtc aatccagctc agctgcaatg aatgaatgaa gtctcccgaa tgaaaatgtt
aaacgaaaaa acccgaacaa caaaaa
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003541 |gb|AE003541| arm:3L  12268628..12534151
estimated- cyto:69B1-69C8  gadfly- seqname:AE003541 
 seq_release:3 
Length = 265524
Score = 640 bits (333), Expect = 0.0 Genome Map
Identities = 360/379 (94%), Gaps = 1/379 (0%)
Strand = Plus / Plus
Query: 9 ggagcaaggagatttggcggaggagccgataacaacaataatgaaattaatggagtaaac 68
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 208657 ggagcaaggagatttggcggaggagccgataacaacaataatgaaattaatggagtaaac
208716
Query: 69 caattaaatccatggaattcccaaatctaaaataaaagctaacttaatacgtttttattt 128
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 208717 caattaaatccatggaattcccaaatctaaaataaaagctaacttaatacgtttttattt
208776
Query: 129 gaatgaaagagtaacaaatcgattgtaatattgtatttcttgtgggcgtaaaacatcgac 188
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 208777 gaatgaaagagtaacaaatcgattgtaatattgtatttcttgtgggcgtaaaacatcgac
208836
Query: 189 aaacgctcgacccgttttactagcatttaaaacaactattatttaagagcattttaaaca 248
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 208837 aaacgctcgacccgttttactagcatttaaaacaactattatttaagagcattttaaaca
208896
Query: 249 tg-nnnnnnnnnnnnnnnntcggcagctacgcgcttctatcaaaagcacaattgtaaaaa 307
|| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 208897 tgaaaaaaagaaaataaaatcggcagctacgcgcttctatcaaaagcacaattgtaaaaa
208956
Query: 308 gtcaatccagctcagctgcaatgaatgaatgaagtctcccgaatgaaaatgttaaacgaa 367
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 208957 gtcaatccagctcagctgcaatgaatgaatgaagtctcccgaatgaaaatgttaaacgaa
209016
Query: 368 aaaacccgaacaacaaaaa 386
||||||| ||||| |||||
Sbjct: 209017 aaaaccccaacaaaaaaaa 209035
\#
anon- EST:Posey146  = new?
>anon- EST:Posey146 
ggcacgaggg acattttaat gttaaaatca tggctatttt tccataaaca attacgccgt
gattcggcgc tcgatatttt cactgagcgg tgattaattg atgaaaggac agtgtgtgga
actgcagggt gtatataaaa ggaattataa atatgtgtat ttgtactcag cacttactga
ggacaaagag atgctctgtt ggcactacaa tattaataag taacatattt gaaagttcgt
ttgcgtgtta aaggctctag gtgcaaagcc ggacagcgat gaataaaaat aaatagtttc
gttatatatc tgattgttta cttgacaaat aaagaataaa actgaaaaaa aaaaaaaaaa
aa
>gadfly| SEG:AABU01002756 |gb|AABU01002756| arm:U  6723424..6923036
estimated-cyto:? gadfly- seqname:AABU01002756   seq_release:3 
Length = 199613
Score = 341 bits (177), Expect = 1e-92 Genome Map
Identities = 177/177 (100%)
Strand = Plus / Plus
Query: 168 cagcacttactgaggacaaagagatgctctgttggcactacaatattaataagtaacata 227
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 23411 cagcacttactgaggacaaagagatgctctgttggcactacaatattaataagtaacata 23470
Query: 228 tttgaaagttcgtttgcgtgttaaaggctctaggtgcaaagccggacagcgatgaataaa 287
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 23471 tttgaaagttcgtttgcgtgttaaaggctctaggtgcaaagccggacagcgatgaataaa 23530
Query: 288 aataaatagtttcgttatatatctgattgtttacttgacaaataaagaataaaactg 344
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 23531 aataaatagtttcgttatatatctgattgtttacttgacaaataaagaataaaactg 23587
Score = 312 bits (162), Expect = 5e-84 Genome Map
Identities = 162/162 (100%)
Strand = Plus / Plus
Query: 9 ggacattttaatgttaaaatcatggctatttttccataaacaattacgccgtgattcggc 68
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22647 ggacattttaatgttaaaatcatggctatttttccataaacaattacgccgtgattcggc 22706
Query: 69 gctcgatattttcactgagcggtgattaattgatgaaaggacagtgtgtggaactgcagg 128
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22707 gctcgatattttcactgagcggtgattaattgatgaaaggacagtgtgtggaactgcagg 22766
Query: 129 gtgtatataaaaggaattataaatatgtgtatttgtactcag 170
||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22767 gtgtatataaaaggaattataaatatgtgtatttgtactcag 22808
\#
anon- EST:Posey152  = ?
>anon- EST:Posey152 
ggcacgaggt cgaaatatca ttttgaataa gttgctcaat ttgcttcgca aagtgattta
ccgatttatc attctctatt ttcatatgtg tacaactaaa taaatgtatt gtaggcataa
gctaaacaac acaataatgc aaaaa
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003795 |gb|AE003795| arm:2R  14519511..14767606
estimated- cyto:56D9-56E5  gadfly- seqname:AE003795 
 seq_release:3 
Length = 248096
Score = 264 bits (137), Expect = 5e-70 Genome Map
Identities = 137/137 (100%)
Strand = Plus / Minus
Query: 9 gtcgaaatatcattttgaataagttgctcaatttgcttcgcaaagtgatttaccgattta 68
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 65060 gtcgaaatatcattttgaataagttgctcaatttgcttcgcaaagtgatttaccgattta 65001
Query: 69 tcattctctattttcatatgtgtacaactaaataaatgtattgtaggcataagctaaaca 128
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 65000 tcattctctattttcatatgtgtacaactaaataaatgtattgtaggcataagctaaaca 64941
Query: 129 acacaataatgcaaaaa 145
|||||||||||||||||
Sbjct: 64940 acacaataatgcaaaaa 64924
\#
anon- EST:Posey155  = ?
>anon- EST:Posey155 
ggcacgagaa agatttaact gtggacgttg agttgaagtg ttgaagaaca cacaaaagaa
aaaaacacga ggaaaacgta acgtctcttt ggtaagaaaa aggaaaacct aaagagcaaa
tgctgtcatc caaaaaccaa aaaaaaaaaa cacaaaaaaa tgaaactgaa ctttttctga
atcaataaaa gacaaattga tttcctgttg gaaaaa
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003795 |gb|AE003795| arm:2R  14519511..14767606
estimated- cyto:56D9-56E5  gadfly- seqname:AE003795 
 seq_release:3 
Length = 248096
Score = 264 bits (137), Expect = 5e-70 Genome Map
Identities = 137/137 (100%)
Strand = Plus / Minus
Query: 9 gtcgaaatatcattttgaataagttgctcaatttgcttcgcaaagtgatttaccgattta 68
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 65060 gtcgaaatatcattttgaataagttgctcaatttgcttcgcaaagtgatttaccgattta 65001
Query: 69 tcattctctattttcatatgtgtacaactaaataaatgtattgtaggcataagctaaaca 128
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 65000 tcattctctattttcatatgtgtacaactaaataaatgtattgtaggcataagctaaaca 64941
Query: 129 acacaataatgcaaaaa 145
|||||||||||||||||
Sbjct: 64940 acacaataatgcaaaaa 64924
\#
anon- EST:Posey156  = EST GM16138
>anon- EST:Posey156 
ggcacgagtc tgtttggggt attgtccaat tggttttaat gggtctattc ttctacataa
atagtgtagc cctcattgag gacttacctc ttgaggagga ataccattcg ttggaagatt
tttatgcagc tgcaaataga gcatacaatc agaatgccta caactgctgg attgccgcat
gtatatatgt tttgactttg ttgctctccg cccagcaatt ttacatgaat agcagagtaa
ctgccaacta atatttcaga tgtagtttcc caactactta aaactagtat tgaaattttc
ccttcgatat atttgttaga ggtgttttcc ttttaataaa gttaaagttc aatttaaaa
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003795 |gb|AE003795| arm:2R  14519511..14767606
estimated- cyto:56D9-56E5  gadfly- seqname:AE003795 
 seq_release:3 
Length = 248096
Score = 264 bits (137), Expect = 5e-70 Genome Map
Identities = 137/137 (100%)
Strand = Plus / Minus
Query: 9 gtcgaaatatcattttgaataagttgctcaatttgcttcgcaaagtgatttaccgattta 68
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 65060 gtcgaaatatcattttgaataagttgctcaatttgcttcgcaaagtgatttaccgattta 65001
Query: 69 tcattctctattttcatatgtgtacaactaaataaatgtattgtaggcataagctaaaca 128
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 65000 tcattctctattttcatatgtgtacaactaaataaatgtattgtaggcataagctaaaca 64941
Query: 129 acacaataatgcaaaaa 145
|||||||||||||||||
Sbjct: 64940 acacaataatgcaaaaa 64924
Database: na_est.dros
>GM16138.complete AY118852
Length = 472
Score = 675 bits (351), Expect = 0.0
Identities = 351/351 (100%)
Strand = Plus / Plus
Query: 9 tctgtttggggtattgtccaattggttttaatgggtctattcttctacataaatagtgta 68
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 107 tctgtttggggtattgtccaattggttttaatgggtctattcttctacataaatagtgta 166
Query: 69 gccctcattgaggacttacctcttgaggaggaataccattcgttggaagatttttatgca 128
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 167 gccctcattgaggacttacctcttgaggaggaataccattcgttggaagatttttatgca 226
Query: 129 gctgcaaatagagcatacaatcagaatgcctacaactgctggattgccgcatgtatatat 188
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 227 gctgcaaatagagcatacaatcagaatgcctacaactgctggattgccgcatgtatatat 286
Query: 189 gttttgactttgttgctctccgcccagcaattttacatgaatagcagagtaactgccaac 248
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 287 gttttgactttgttgctctccgcccagcaattttacatgaatagcagagtaactgccaac 346
Query: 249 taatatttcagatgtagtttcccaactacttaaaactagtattgaaattttcccttcgat 308
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 347 taatatttcagatgtagtttcccaactacttaaaactagtattgaaattttcccttcgat 406
Query: 309 atatttgttagaggtgttttccttttaataaagttaaagttcaatttaaaa 359
|||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 407 atatttgttagaggtgttttccttttaataaagttaaagttcaatttaaaa 457
\#
anon- EST:Posey171  = CG12187
>anon- EST:Posey171 
ggcacgaggc gaaaccggaa acggaagcgc aggcgaacgc ttggagccca cctacataca
actcgtattc gtagttaaga aacacattaa cgaagtgcta aacggaggag agagataagt
gcagaatcat tttcgagagc taactgaatt tactcgttta ccttatagca gatgctttgt
agctatgtaa ctcctgtcag atgggtgata acttaacatt gatttcgatc acgacacatt
gtatagacta cctacttcgt aatcgtaact cgtaactgta actgtaactc taaccttata
ttgtaactgt aactaatacc tgtaactgaa ttatgtacta aatttatgag aaacctttac
aaaagtcact tgggcaggtg caaaggtccc tgaaaagagc tccctgggag atggaattgt
gaaaaactga tgaaattttt ttagattatc cgcactaacc gccgctcgag gttgagatat
tcatttcaaa accaatatgt ataaatttac aactcaacgc tatacgatac ttgaatatat
atctatatac aaacagttaa tagtcactaa tgcgtatacc agcgtaccga aatgtgctag
caacctaaat ttaactgaaa aacggctaac aaagaaatgt gaaaataaag tctctctatt
taactgcaaa acaaaacgaa aaa
Database: dmel_all_transcript_r320
>CG12187-RA type=mRNA;
loc= 3L:complement (2651232..2653522,2653694..2653913,
2654215..2654339,2659167..2659408,2659527..2659781,
2659842..2660098,2660248..2660496,2662850..2663190,
2665182..2665317,2670118..2670316); ID=CG12187-RA;
name=CG12187-RA; db_xref='CG12187,FlyBase:FBgn0035367';
len=4315
Length = 4315
Genome Map
Score = 1250 bits (650), Expect = 0.0
Identities = 657/664 (98%)
Strand = Plus / Plus
Query: 9 gcgaaaccggaaacggaagcgcaggcgaacgcttggagcccacctacatacaactcgtat 68
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3652 gcgaaaccggaaacggaagcgcaggcgaacgcttggagcccacctacatacaactcgtat 3711
Query: 69 tcgtagttaagaaacacattaacgaagtgctaaacggaggagagagataagtgcagaatc 128
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3712 tcgtagttaagaaacacattaacgaagtgctaaacggaggagagagataagtgcagaatc 3771
Query: 129 attttcgagagctaactgaatttactcgtttaccttatagcagatgctttgtagctatgt 188
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3772 attttcgagagctaactgaatttactcgtttaccttatagcagatgctttgtagctatgt 3831
Query: 189 aactcctgtcagatgggtgataacttaacattgatttcgatcacgacacattgtatagac 248
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3832 aactcctgtcagatgggtgataacttaacattgatttcgatcacgacacattgtatagac 3891
Query: 249 tacctacttcgtaatcgtaactcgtaactgtaactgtaactctaaccttatattgtaact 308
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3892 tacctacttcgtaatcgtaactcgtaactgtaactgtaactctaaccttatattgtaact 3951
Query: 309 gtaactaatacctgtaactgaattatgtactaaatttatgagaaacctttacaaaagtca 368
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3952 gtaactaatacctgtaactgaattatgtactaaatttatgagaaacctttacaaaagtca 4011
Query: 369 cttgggcaggtgcaaaggtccctgaaaagagctccctgggagatggaattgtgaaaaact 428
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4012 cttgggcaggtgcaaaggtccctgaaaagagctccctgggagatggaattgtgaaaaact 4071
Query: 429 gatgaaannnnnnnagattatccgcactaaccgccgctcgaggttgagatattcatttca 488
||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4072 gatgaaatttttttagattatccgcactaaccgccgctcgaggttgagatattcatttca 4131
Query: 489 aaaccaatatgtataaatttacaactcaacgctatacgatacttgaatatatatctatat 548
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4132 aaaccaatatgtataaatttacaactcaacgctatacgatacttgaatatatatctatat 4191
Query: 549 acaaacagttaatagtcactaatgcgtataccagcgtaccgaaatgtgctagcaacctaa 608
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4192 acaaacagttaatagtcactaatgcgtataccagcgtaccgaaatgtgctagcaacctaa 4251
Query: 609 atttaactgaaaaacggctaacaaagaaatgtgaaaataaagtctctctatttaactgca 668
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4252 atttaactgaaaaacggctaacaaagaaatgtgaaaataaagtctctctatttaactgca 4311
Query: 669 aaac 672
||||
Sbjct: 4312 aaac 4315
\#
anon- EST:Posey175  = end of CG13203 ?
>anon- EST:Posey175 
ggcacgagct cgtgccgaat tcggcacgag ccggcgtcca cgcgtagttc tagatggtac
cgtataccca ttgaacccgt atttactgta tggcggaact caagcttatg tggacgctga
gcctggccaa taattgtaga cccaacgtag atccttaaca ataaagagta ctagaagaca
cctcaaaaa
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003826 |gb|AE003826| arm:2R  6219987..6530078
estimated- cyto:47D5-47F15  gadfly- seqname:AE003826 
 seq_release:3 
Length = 310092
Score = 246 bits (128), Expect = 1e-64 Genome Map
Identities = 149/157 (94%), Gaps = 7/157 (4%)
Strand = Plus / Plus
Query: 31 ccggcgtccacgcgtagttctagatggtaccgtatacccattgaacccgtatttactgta 90
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 221679 ccggcgtccacgcgtagttctagatggtaccgtagacccattgaacccgtatttactgta
221738
Query: 91 tggcggaactcaagcttatgtggacgctgagcctggccaataattgtagacccaacgtag 150
|||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 221739 tggc-------aagcttatgtggacgctgagcctggccaataattgtagacccaacgtag
221791
Query: 151 atccttaacaataaagagtactagaagacacctcaaa 187
|||||||||||||||||||||||||||||||||||||
Sbjct: 221792 atccttaacaataaagagtactagaagacacctcaaa 221828
\#
anon- EST:Posey178  = ? end CG31369 ?
>anon- EST:Posey178 
ggcacgaggg aagagctgca acagtaattt gaatttggaa tgcaccggag ggaacgagag
cgctgcaaat tgtgtacata ttttgtctct gtctgtttcc ggtcgcctgc cattgtgtgc
gtttgcttga gcttgtgcct gtgtgtgtga ttgtgggtgt atttcgtgta aataaatgct
gtgcaaaaac agaaacagca acatcagaag aaacaggaat aacaagcgaa atggcaaaaa
gtgcagttaa gcgtggaaat tgcattaaaa attgagcaaa aaaaaattgc gaaaacaaaa
ggcggcgaaa agactaaaaa cggaacaaac aaagacgcaa aacgaaacgc tggagttaac
gagcgctaaa aagcaaaaaa
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003679 |gb|AE003679| arm:3R  4269603..4486596
estimated- cyto:85A1-85A5  gadfly- seqname:AE003679 
 seq_release:3 
Length = 216994
Score = 494 bits (257), Expect = e-139 Genome Map
Identities = 257/257 (100%)
Strand = Plus / Minus
Query: 9 ggaagagctgcaacagtaatttgaatttggaatgcaccggagggaacgagagcgctgcaa 68
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 645 ggaagagctgcaacagtaatttgaatttggaatgcaccggagggaacgagagcgctgcaa 586
Query: 69 attgtgtacatattttgtctctgtctgtttccggtcgcctgccattgtgtgcgtttgctt 128
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 585 attgtgtacatattttgtctctgtctgtttccggtcgcctgccattgtgtgcgtttgctt 526
Query: 129 gagcttgtgcctgtgtgtgtgattgtgggtgtatttcgtgtaaataaatgctgtgcaaaa 188
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 525 gagcttgtgcctgtgtgtgtgattgtgggtgtatttcgtgtaaataaatgctgtgcaaaa 466
Query: 189 acagaaacagcaacatcagaagaaacaggaataacaagcgaaatggcaaaaagtgcagtt 248
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 465 acagaaacagcaacatcagaagaaacaggaataacaagcgaaatggcaaaaagtgcagtt 406
Query: 249 aagcgtggaaattgcat 265
|||||||||||||||||
Sbjct: 405 aagcgtggaaattgcat 389
Score = 37.2 bits (19), Expect = 0.29 Genome Map
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 349 gctggagttaacgagcgct 367
|||||||||||||||||||
Sbjct: 305 gctggagttaacgagcgct 287
\#
anon- EST:Posey186  = CG6549
>anon- EST:Posey186 
ggcacgagct cgtgccgaat tcggcacgag ggacaatgcc aggcgaaaga acattcagca
gtacgacgaa gtttacccca tgatggtaga ttattttgaa caggccttaa aggcacttcc
ataaatgtct aatgtattat gtatctagaa ctatgtatgt atgtatgtaa gagcacgaat
atgtttggaa taaacatatg catggcatcc ttctattaaa aa
Database: dmel_all_transcript_r320
>CG6549-RC type=mRNA;
loc= 2L:complement (17456524..17457196,17457255..17458325,
17458379..17459002,17459052..17459150); ID=fws-RC;
name=fws-RC; db_xref='CG6549,FlyBase:FBgn0024689';
len=2467
Length = 2467
Genome Map
Score = 364 bits (189), Expect = e-100
Identities = 189/189 (100%)
Strand = Plus / Plus
Query: 30 gggacaatgccaggcgaaagaacattcagcagtacgacgaagtttaccccatgatggtag 89
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2279 gggacaatgccaggcgaaagaacattcagcagtacgacgaagtttaccccatgatggtag 2338
Query: 90 attattttgaacaggccttaaaggcacttccataaatgtctaatgtattatgtatctaga 149
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2339 attattttgaacaggccttaaaggcacttccataaatgtctaatgtattatgtatctaga 2398
Query: 150 actatgtatgtatgtatgtaagagcacgaatatgtttggaataaacatatgcatggcatc 209
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2399 actatgtatgtatgtatgtaagagcacgaatatgtttggaataaacatatgcatggcatc 2458
Query: 210 cttctatta 218
|||||||||
Sbjct: 2459 cttctatta 2467
\#
anon- EST:Posey204  = CG10071
>anon- EST:Posey204 
gggcacgagc aaccagaaca agaaggccca tcgcaatggc atcaagcgcc cgctgcgcaa
acgccacgag tccactctgg gtatggatgt gaaattcctg atcaaccagc gctacgcacg
caagggaaac ctttcccgcg aggagtccgt gaagcgctac aacgagcgca tcgcttccca
gaagggcaag ccaaagcctg ttactctgta gatgattgcc ccgcttgtgg ataattaaag
gacaattcag tttaacaaaa a
Database: dmel_all_transcript_r320
>CG10071-RC type=mRNA;
loc= 2R:join (16337395..16337425,16337605..16337712,
16337782..16337961); ID=RpL29-RC; name=RpL29-RC;
db_xref='CG10071,FlyBase:FBgn0016726'; len=319
Length = 319
Genome Map
Score = 466 bits (241), Expect = e-131
Identities = 247/250 (98%)
Strand = Plus / Plus
Query: 18 caaccagaacaagaaggcccatcgcaatggcatcaagcgcccgctgcgcaaacgccacga 77
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 67 caaccagaacaagaaggcccatcgtaatggcatcaagcgcccgctgcgcaaacgccacga 126
Query: 78 gtccactctgggtatggatgtgaaattcctgatcaaccagcgctacgcacgcaagggaaa 137
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 127 gtccactctgggtatggatgtgaaatttctgatcaaccagcgctacgcacgcaagggaaa 186
Query: 138 cctttcccgcgaggagtccgtgaagcgctacaacgagcgcatcgcttcccagaagggcaa 197
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 187 cctttcccgcgaggagtccgtgaagcgctacaacgagcgcatcgcttcccagaagggcaa 246
Query: 198 gccaaagcctgttactctgtagatgattgccccgcttgtggataattaaaggacaattca 257
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 247 gccaaagcctgttactctgtagatgattgccccgcgtgtggataattaaaggacaattca 306
Query: 258 gtttaacaaa 267
||||||||||
Sbjct: 307 gtttaacaaa 316
\#
anon- EST:Posey215  = CG2985?
>anon- EST:Posey215 
ggcacgaggc gagtgggtat cttaagaaag actgtactta atatttaaga cactttggcc
tgcgctttta ccaatatttt tgtggcccaa cttggcccga actccttggt tccaacaata
ttttgcattg atatgctaga gctaccaaca agtatatagt attaatattt ctaacaattc
ggaatgtgca cttaactaag cgaagattga aactaaaaat cagaagatgg aaacatccta
tttaaatagg tggaagttta aataagcaaa agtctctcgc ctaagccctg atcctaaact
cttggctgta tttctaattg ttatcgcttc atgttgaggt ttattgttat aacgccagcc
tcccatgagc aatactcccc ccaaattacc gtaaacaaat tattttctaa tctgagccca
agccataagt ggagaagatt agacctcaac accacaaaaa caccgacaac aataaaataa
atctaagttt acaaaaccaa aaa
Database: dmel_all_transcript_r320
>CG2985-RA type=mRNA; loc= X:join (9793758..9794044,9794122..9795724); Genome
Map
ID=Yp1-RA; name=Yp1-RA;
db_xref='CG2985,FlyBase:FBgn0004045'; len=1890
Length = 1890
Score = 431 bits (224), Expect = e-120
Identities = 224/224 (100%)
Strand = Plus / Minus
Query: 278 cgcctaagccctgatcctaaactcttggctgtatttctaattgttatcgcttcatgttga 337
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1890 cgcctaagccctgatcctaaactcttggctgtatttctaattgttatcgcttcatgttga 1831
Query: 338 ggtttattgttataacgccagcctcccatgagcaatactccccccaaattaccgtaaaca 397
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1830 ggtttattgttataacgccagcctcccatgagcaatactccccccaaattaccgtaaaca 1771
Query: 398 aattattttctaatctgagcccaagccataagtggagaagattagacctcaacaccacaa 457
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1770 aattattttctaatctgagcccaagccataagtggagaagattagacctcaacaccacaa 1711
Query: 458 aaacaccgacaacaataaaataaatctaagtttacaaaaccaaa 501
||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1710 aaacaccgacaacaataaaataaatctaagtttacaaaaccaaa 1667
\#
anon- EST:Posey216  = end of CG32423
>anon- EST:Posey216 
ggcacgaggg gagaataagc ataagcttac aaagaccgag aagaaatggg gaatcttgta
ctagttttta gcatattttt tgtgctcatc agtcgattta atgaatgaat tttttgtagc
tgtctacagt tttttacgtt aactgttttt tagacatatt aatgaggaaa gtaaaaacca
acaaaaacaa cctagaaata gtatattttt tctgcatatg acaagttgtt gaggaaagag
aagaacgatg tttgattagc atggaaacca agaggcaaac actttttaaa agggaatagc
gaaacaaacc gaggcaacac acaaaagtag cgaaacacag aaaacagaaa ataaaatttg
aaactgtaga attgtagttt agctttgtga aggctggcga agaatgtacg attttttgaa
ggatcagcta ggatcgaaaa gaacaacagc aacaacaaca gcagcagcaa caacaactgg
cacaggcagt agcagaaatg tataacaaaa accaagaaaa ttaatgttaa attaaacaac
aaaaaagaaa aaacaaaata atgaagtaag atagaagaaa ctacgtttag taaacttagt
taataagcga agatttcttt agtcttgtaa gcgtctctta agtagagttg aacatgaagt
tgagtatgga gtttagaatt gaaattaaac ctttgtcaaa gcctagcata tttatttttc
cgagacacac acacacacac tgacacacaa acacagcaag acacaccaac acggacgcac
ctatcaagcc taagcattgt atttgtgatt ttttcgaatg ttaattgatt aacgaaacac
gatgagcaaa ataagcgaaa caagggaaac atcaagtggg cgatgtgggt gggagatagt
gtggcgaagt gagaaatttt tgagaatctc cgtttgagca aggacaccct ctcaccacaa
acaacattcc tgagcaaagt ctttgatttg attttgatat aaaaaaaatt tgtatgtgtt
gatacgattt gattttcgag tttagagctg tcgagtcgcc taactgaact atctacatat
atatatacat tatatatata tacatatata tatatataaa aacgtagaaa cacaacgcca
aaagtcttcc taagcctaaa accaaaacaa caacataatg caaatgtttt tttttttatt
cgattattt gctttagact gactacgaac tgaaactgta acaataacaa caaatgcagg
attgtcaacc caaaaacaaa aa
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003567 |gb|AE003567| arm:3L  5083015..5237352
estimated- cyto:64C9-64C12  gadfly- seqname:AE003567 
 seq_release:3 
Length = 154338
Score = 833 bits (433), Expect = 0.0 Genome Map
Identities = 433/433 (100%)
Strand = Plus / Minus
Query: 9 gggagaataagcataagcttacaaagaccgagaagaaatggggaatcttgtactagtttt 68
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 36359 gggagaataagcataagcttacaaagaccgagaagaaatggggaatcttgtactagtttt 36300
Query: 69 tagcatattttttgtgctcatcagtcgatttaatgaatgaattttttgtagctgtctaca 128
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 36299 tagcatattttttgtgctcatcagtcgatttaatgaatgaattttttgtagctgtctaca 36240
Query: 129 gttttttacgttaactgttttttagacatattaatgaggaaagtaaaaaccaacaaaaac 188
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 36239 gttttttacgttaactgttttttagacatattaatgaggaaagtaaaaaccaacaaaaac 36180
Query: 189 aacctagaaatagtatattttttctgcatatgacaagttgttgaggaaagagaagaacga 248
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 36179 aacctagaaatagtatattttttctgcatatgacaagttgttgaggaaagagaagaacga 36120
Query: 249 tgtttgattagcatggaaaccaagaggcaaacactttttaaaagggaatagcgaaacaaa 308
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 36119 tgtttgattagcatggaaaccaagaggcaaacactttttaaaagggaatagcgaaacaaa 36060
Query: 309 ccgaggcaacacacaaaagtagcgaaacacagaaaacagaaaataaaatttgaaactgta 368
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 36059 ccgaggcaacacacaaaagtagcgaaacacagaaaacagaaaataaaatttgaaactgta 36000
Query: 369 gaattgtagtttagctttgtgaaggctggcgaagaatgtacgattttttgaaggatcagc 428
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 35999 gaattgtagtttagctttgtgaaggctggcgaagaatgtacgattttttgaaggatcagc 35940
Query: 429 taggatcgaaaag 441
|||||||||||||
Sbjct: 35939 taggatcgaaaag 35927
Score = 565 bits (294), Expect = e-160 Genome Map
Identities = 302/310 (97%)
Strand = Plus / Minus
Query: 767 caacacggacgcacctatcaagcctaagcattgtatttgtgattttttcgaatgttaatt 826
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 35601 caacacggacgcacctatcaagcctaagcattgtatttgtgattttttcgaatgttaatt 35542
Query: 827 gattaacgaaacacgatgagcaaaataagcgaaacaagggaaacatcaagtgggcgatgt 886
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 35541 gattaacgaaacacgatgagcaaaataagcgaaacaagggaaacatcaagtgggcgatgt 35482
Query: 887 gggtgggagatagtgtggcgaagtgagaaatttttgagaatctccgtttgagcaaggaca 946
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 35481 gggtgggagatagtgtggcgaagtgagaaatttttgagaatctccgtttgagcaaggaca 35422
Query: 947 ccctctcaccacaaacaacattcctgagcaaagtctttgatttgattttgatatnnnnnn 1006
||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 35421 ccctctcaccacaaacaacattcctgagcaaagtctttgatttgattttgatataaaaaa 35362
Query: 1007 nntttgtatgtgttgatacgatttgattttcgagtttagagctgtcgagtcgcctaactg 1066
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 35361 aatttgtatgtgttgatacgatttgattttcgagtttagagctgtcgagtcgcctaactg 35302
Query: 1067 aactatctac 1076
||||||||||
Sbjct: 35301 aactatctac 35292
Score = 404 bits (210), Expect = e-111 Genome Map
Identities = 228/246 (92%)
Strand = Plus / Minus
Query: 478 tggcacaggcagtagcagaaatgtataacaaaaaccaagaaaattaatgttaaattaaac 537
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 35890 tggcacaggcagtagcagaaatgtataacaaaaaccaagaaaattaatgttaaattaaac 35831
Query: 538 aacnnnnnnnnnnnnnnnnnntaatgaagtaagatagaagaaactacgtttagtaaactt 597
||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 35830 aacaaaaaagaaaaaacaaaataatgaagtaagatagaagaaactacgtttagtaaactt 35771
Query: 598 agttaataagcgaagatttctttagtcttgtaagcgtctcttaagtagagttgaacatga 657
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 35770 agttaataagcgaagatttctttagtcttgtaagcgtctcttaagtagagttgaacatga 35711
Query: 658 agttgagtatggagtttagaattgaaattaaacctttgtcaaagcctagcatatttattt 717
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 35710 agttgagtatggagtttagaattgaaattaaacctttgtcaaagcctagcatatttattt 35651
Query: 718 ttccga 723
||||||
Sbjct: 35650 ttccga 35645
Score = 239 bits (124), Expect = 2e-61 Genome Map
Identities = 144/157 (91%), Gaps = 1/157 (0%)
Strand = Plus / Minus
Query: 1126 agaaacacaacgccaaaagtcttcctaagcctaaaaccaaaacaacaacataatgcaaat 1185
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 35241 agaaacacaacgccaaaagtcttcctaagcctaaaaccaaaacaacaacataatgcaaat 35182
Query: 1186 gnnnnnnnnnnnatt-cgattatttgctttagactgactacgaactgaaactgtaacaat 1244
| ||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 35181 gtttttttttttattacgattatttgctttagactgactacgaactgaaactgtaacaat 35122
Query: 1245 aacaacaaatgcaggattgtcaacccaaaaacaaaaa 1281
|||||||||||||||||||| ||||||||||||||||
Sbjct: 35121 aacaacaaatgcaggattgtaaacccaaaaacaaaaa 35085
\#
anon- EST:Posey221  = CG3620
>anon- EST:Posey221 
gcacgagcaa acaaacgcga acgcgaagga agcttcaaaa gagagacaag agcgtgaaaa
ggaggtggag aggagctgcg gagaatctaa gtggctgtga gctgaaatac aaaaaaaaaa
aaaacaagtg caaccaaata cagtgttacc tgttgtgagt aaacttaagg aaacgtggag
agagcgagag agtgcgacag ccgactgatc aaactgtaaa tcttgcaatg ctcttcaaac
tgaaattcgc aaggcgggaa aaaacaaaca aatataaata aacaagaata acaaacaaaa
ataggtagca aaagcaggaa caacaaaagc cgaagccaat taattaaata catatctact
tcagtacatt gtcgtgctgc catcaaacta aactaaatgt tgcgctgcgt cgaggatttt
aaataaaagg gaacctgccg ctcggaagtt gtggcagaag tgcagcaagt gctgccgggc
caagttcaat tagcccggaa aacggccatg tgatctgcta taaatgcgat tgtatataca
cacacacaca taatcccgtt gggagcagcg atagataggg ccagtatata atatgtccgg
aaattaagtg gactgtagaa aaa
Database: dmel_all_transcript_r320
CG3620-RB type=mRNA;
loc= X:join (4063242..4063771,4073412..4073456,
4089620..4090203,4090269..4090328,4094083..4094229,
4095087..4095166,4097656..4097892,4097961..4098127,
4098192..4098496,4098892..4099056,4099121..4099487,
4099683..4100946,4101011..4101167,4101232..4101321,
4102582..4103070); ID=norpA-RB; name=norpA-RB;
db_xref='CG3620,FlyBase:FBgn0004625'; len=4687
Length = 4687
Genome Map
Score = 414 bits (215), Expect = e-115
Identities = 245/264 (92%), Gaps = 1/264 (0%)
Strand = Plus / Plus
Query: 360 ttcagtacattgtcgtgctgccatcaaactaaactaaatgttgcgctgcgtcgaggattt 419
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 531 ttcagtacattgtcgtgctgccatcaaactaaactaaatgttgcgctgcgtcgaggattt 590
Query: 420 taaataaaagggaacctgccgctcggaagttgtggcagaagtgcagcaagtgctgccggg 479
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 591 taaataaaagggaacctgccgctcggaagttgtggcagaagtgcagcaagtgctgccggg 650
Query: 480 ccaagttcaattagcccggaaaacggccatgtgatctgctataaatgcgattgtatatnn 539
|||||||||||||||| | ||| | ||||||||||||||||||||||||||||||||
Sbjct: 651 ccaagttcaattagccggaaaacggaccatgtgatctgctataaatgcgattgtatatac 710
Query: 540 nnnnnnnnnnntaatcccgttgggagcagcgatagatagggccagtatataatatgtccg 599
|||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 711 acacacacacataat-ccgttgggagcagcgatagatagggccagtatataatatgtccg 769
Query: 600 gaaattaagtggactgtagaaaaa 623
||||||||||||||||||||||||
Sbjct: 770 gaaattaagtggactgtagaaaaa 793
Score = 164 bits (85), Expect = 1e-39
Identities = 85/85 (100%)
Strand = Plus / Plus
Query: 8 caaacaaacgcgaacgcgaaggaagcttcaaaagagagacaagagcgtgaaaaggaggtg 67
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 447 caaacaaacgcgaacgcgaaggaagcttcaaaagagagacaagagcgtgaaaaggaggtg 506
Query: 68 gagaggagctgcggagaatctaagt 92
|||||||||||||||||||||||||
Sbjct: 507 gagaggagctgcggagaatctaagt 531
\#
anon- EST:Posey226  = end of CG32712 ?
>anon- EST:Posey226 
ggcacgagtt tttttttttt tttttatacc taaacctatc tctttccttt ccgcgctagt
tatttgttcc ctaaaggcat tttcatttct cgattttgtt tatgcaaatt aaaacattaa
aaaaaaaaaa ataaacaaaa aaaaaattgt ataccaaaaa tgtgtataaa taatcgaggg
aaagaaaagt ttgatatttc tcactaatta tatgtaattt cccttttact ttcgttttag
ctattttgat tatgcacaag ttgaacgata tgaaagttgg tttcatgttt ttaagcacaa
atgaaaattg aacttgatgt acgaatgagg caattcacgt ttaattggaa aacatcaatt
ttgtttgcgt atgtacaatg attttgggtt ctgttgtggt ctggaagtac tatttcttca
atgattgtac aattggctat cgtatctcat ttcgttttcc tatttatggg tgaaggcacg
ccaaaacatc tagagtttg
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003444 |gb|AE003444| arm:X  8154224..8453909
estimated- cyto:7E7-8A2  gadfly- seqname:AE003444 
 seq_release:3 
Length = 299686
Score = 679 bits (353), Expect = 0.0 Genome Map
Identities = 353/353 (100%)
Strand = Plus / Minus
Query: 147 ttgtataccaaaaatgtgtataaataatcgagggaaagaaaagtttgatatttctcacta 206
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15777 ttgtataccaaaaatgtgtataaataatcgagggaaagaaaagtttgatatttctcacta 15718
Query: 207 attatatgtaatttcccttttactttcgttttagctattttgattatgcacaagttgaac 266
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15717 attatatgtaatttcccttttactttcgttttagctattttgattatgcacaagttgaac 15658
Query: 267 gatatgaaagttggtttcatgtttttaagcacaaatgaaaattgaacttgatgtacgaat 326
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15657 gatatgaaagttggtttcatgtttttaagcacaaatgaaaattgaacttgatgtacgaat 15598
Query: 327 gaggcaattcacgtttaattggaaaacatcaattttgtttgcgtatgtacaatgattttg 386
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15597 gaggcaattcacgtttaattggaaaacatcaattttgtttgcgtatgtacaatgattttg 15538
Query: 387 ggttctgttgtggtctggaagtactatttcttcaatgattgtacaattggctatcgtatc 446
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15537 ggttctgttgtggtctggaagtactatttcttcaatgattgtacaattggctatcgtatc 15478
Query: 447 tcatttcgttttcctatttatgggtgaaggcacgccaaaacatctagagtttg 499
|||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15477 tcatttcgttttcctatttatgggtgaaggcacgccaaaacatctagagtttg 15425
Score = 179 bits (93), Expect = 6e-44 Genome Map
Identities = 93/93 (100%)
Strand = Plus / Minus
Query: 26 atacctaaacctatctctttcctttccgcgctagttatttgttccctaaaggcattttca 85
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15898 atacctaaacctatctctttcctttccgcgctagttatttgttccctaaaggcattttca 15839
Query: 86 tttctcgattttgtttatgcaaattaaaacatt 118
|||||||||||||||||||||||||||||||||
Sbjct: 15838 tttctcgattttgtttatgcaaattaaaacatt 15806
\#
anon- EST:Posey232  = CG18815
>anon- EST:Posey232 
ggcagagcca tagcactctt agaacgtacg aaagcccccg acccagcccg ttgcattcca
actattcacg caatatggag cgcagtaaga gagtcacact gagagttata cgagtaggct
ctctcgtagc ccaattatgg aaattatcac tgaaaaatca attcgaaaag caatcaatta
ttatacacac acggtagcta tacctaatta aatgccaaaa tacaagcaat ttgcgaggga
aattctccag cgcgagacgt ttcagagtat agaagcaact gactttgata tttcttcgct
gctaattatt tcggtttact tatttgggac ttgttcgtat ttnaattgaa attaataaag
ttgtattatc caagga
Database: dmel_all_transcript_r320
>CG18815-RC type=mRNA;
loc= 3L:join (11585749..11585782,11585875..11586033,
11586095..11586126,11586493..11587036,
11587113..11587531); ID=CG18815-RC; name=CG18815-RC;
db_xref='CG18815,FlyBase:FBgn0042138'; len=1188
Length = 1188
Genome Map
Score = 685 bits (356), Expect = 0.0
Identities = 363/367 (98%)
Strand = Plus / Plus
Query: 8 ccatagcactcttagaacgtacgaaagcccccgacccagcccgttgcattccaactattc 67
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 808 ccatagcactcttagaacgtacgaaagcccccgacccagcccgttgcattccaactattc 867
Query: 68 acgcaatatggagcgcagtaagagagtcacactgagagttatacgagtaggctctctcgt 127
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 868 acgcaatatggagcgcagtaagagagtcacactgagagttatacgagtaggctctctcgt 927
Query: 128 agcccaattatggaaattatcactgaaaaatcaattcgaaaagcaatcaattattataca 187
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 928 agcccaattatggaaattatcactgaaaaatcaattcgaaaagcaatcaattattataca 987
Query: 188 cacacggtagctatacctaattaaatgccaaaatacaagcaatttgcgagggaaattctc 247
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 988 cacacggtagctatacctaattaaatgccaaaatacaagcaatttgcgagggaaattctc 1047
Query: 248 cagcgcgagacgtttcagagtatagaagcaactgactttgatatttcttcgctgctaatt 307
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1048 cagcgcgagacgtttcagagtatagaagcaactgactttgatatttcttcgctgctaatt 1107
Query: 308 atttcggtttacttatttgggacttgttcgtatttnaattgaaattaataaagttgtatt 367
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||
Sbjct: 1108 atttcggtttacttatttgggacttgttcgtatttaaattgaaattaataaagttatata 1167
Query: 368 atccaag 374
||| |||
Sbjct: 1168 atcaaag 1174
\#
anon- EST:Posey243  = CG32172
>anon- EST:Posey243 
ggcacgagcg ctggcgcgcc acgccccccg cccctcccac tgtcacgcgc tcgccacgcc
ccccagttgc cgccccatta gcagcgggca gatggacaac gtgtgggtgg cccacaagga
catctagtaa cacgacgccc aacagcagcc gcaaggtctg atacgccgcc cgccacgccc
atcgtgtttg ggcggcagag gaagcggtcc ggaagcggaa acggaaacgg aaacgggcga
gcaaaatggt ggcgcggtat cgcgggcaag gcgacggcgc gtccacaaaa aataaccata
gagacgttta aggcaaattc taaatgaaca aaagtataaa ccaaa
Database: dmel_all_transcript_r320
>CG32172-RA type=mRNA; loc= 3L:complement (17348426..17350337); Genome Map
ID=noe-RA; name=noe-RA;
db_xref='CG32172,FlyBase:FBgn0026197'; len=1912
Length = 1912
Score = 540 bits (281), Expect = e-153
Identities = 281/281 (100%)
Strand = Plus / Plus
Query: 65 agttgccgccccattagcagcgggcagatggacaacgtgtgggtggcccacaaggacatc 124
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 704 agttgccgccccattagcagcgggcagatggacaacgtgtgggtggcccacaaggacatc 763
Query: 125 tagtaacacgacgcccaacagcagccgcaaggtctgatacgccgcccgccacgcccatcg 184
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 764 tagtaacacgacgcccaacagcagccgcaaggtctgatacgccgcccgccacgcccatcg 823
Query: 185 tgtttgggcggcagaggaagcggtccggaagcggaaacggaaacggaaacgggcgagcaa 244
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 824 tgtttgggcggcagaggaagcggtccggaagcggaaacggaaacggaaacgggcgagcaa 883
Query: 245 aatggtggcgcggtatcgcgggcaaggcgacggcgcgtccacaaaaaataaccatagaga 304
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 884 aatggtggcgcggtatcgcgggcaaggcgacggcgcgtccacaaaaaataaccatagaga 943
Query: 305 cgtttaaggcaaattctaaatgaacaaaagtataaaccaaa 345
|||||||||||||||||||||||||||||||||||||||||
Sbjct: 944 cgtttaaggcaaattctaaatgaacaaaagtataaaccaaa 984
\#
anon- EST:Posey246  = CG5627
>anon- EST:Posey246 
ggcacgagta ttcatagagt tgattgtttt gtctttaagc atagtggtga acaaattatg
ttacaaaatt gcaaagtttt gctgtctgta aatacacgaa gtatcaatat ggatcttaaa
cttaagcgtg cgcataaacg tggtattgtc cttggtctct agagccaaag ttacagtatt
ctccaatctt cctcttccgc acggatcgcg aaagccccgc gatccatcag ttatgctata
tacatatata tatatatata tatgtaccgt aatcgattat actttagcca aatcatatca
ttagccgcct ctcactaatc ccatagacaa attgtttcct gctaagcttt aaggcagaaa
gcgccaaaca aaaacaaaaa ctcgcttacg actacctaaa acatagataa tgacaaatat
atatatacat acatacatac atatatatac actcagatcg ggacttgact tcactgtggg
gccctttgag agggcacaac aaacgaaaca caaacggaaa ttgaaggcaa tctagttagg
gatatagtat actataccaa ctaaattcaa actaacaaac aaaatattaa aatattatgt
gaatatctac cagacaacta cgatcataca taaagtaaat atatatatat ataaatatat
atttatggta aaggaattta actagttcgt acagaaaata ttaagagatt gtatgacagc
aagaagtggt cctaagttca gatctattgg gatcggtagt ttaaggaatt gtcagggaac
acgagcacgg acgacggaga gttttggatt aacggggact ctggagagca ataagtatgt
gtatgtgtat gtagtttgta aaaggagatc ggcgtacatc caaaatacac acatacacac
acatatatat atatatatat ctgaaaatat atataaaaaa tataactatt tttttgttag
ctggctctgg atgttaacca caaataaagc ccagcaccca tatatatata tatatacata
cctctttagc cgtgtatata tgtatatgat cgattgtatt tttcaaagtt caaagcgaga
aataaaaaaa aataaaaaca aaaa
Database: dmel_all_transcript_r320
>CG5627-GEF-RA type=mRNA;
loc= X:join (14824267..14824389,14824570..14824903,
14825128..14825627,14825681..14826042,14826101..14826258,
14828653..14829779,14829848..14830051,14830263..14830313,
14830827..14831196,14831257..14831642,14831704..14832186,
14832614..14832709,14833027..14833284,14833343..14833582,
14833647..14833919,14833991..14834158,14840711..14840783,
14840861..14840907,14842082..14844776); ID=rab3-GEF-RA;
name=rab3-GEF-RA; db_xref='CG5627,FlyBase:FBgn0030613';
len=7948
Length = 7948
Genome Map
Score = 779 bits (405), Expect = 0.0
Identities = 429/453 (94%)
Strand = Plus / Plus
Query: 450 cactcagatcgggacttgacttcactgtggggccctttgagagggcacaacaaacgaaac 509
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 7297 cactcagatcgggacttgacttcactgtggggccctttgagagggcacaacaaacgaaac 7356
Query: 510 acaaacggaaattgaaggcaatctagttagggatatagtatactataccaactaaattca 569
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 7357 acaaacggaaattgaaggcaatctagttagggatatagtatactataccaactaaattca 7416
Query: 570 aactaacaaacaaaatattaaaatattatgtgaatatctaccagacaactacgatcatac 629
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 7417 aactaacaaacaaaatattaaaatattatgtgaatatctaccagacaactacgatcatac 7476
Query: 630 ataaagtaannnnnnnnnnnnnnnnnnnnnnnnttatggtaaaggaatttaactagttcg 689
||||||||| |||||||||||||||||||||||||||
Sbjct: 7477 ataaagtaaatatatatatatataaatatatatttatggtaaaggaatttaactagttcg 7536
Query: 690 tacagaaaatattaagagattgtatgacagcaagaagtggtcctaagttcagatctattg 749
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 7537 tacagaaaatattaagagattgtatgacagcaagaagtggtcctaagttcagatctattg 7596
Query: 750 ggatcggtagtttaaggaattgtcagggaacacgagcacggacgacggagagttttggat 809
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 7597 ggatcggtagtttaaggaattgtcagggaacacgagcacggacgacggagagttttggat 7656
Query: 810 taacggggactctggagagcaataagtatgtgtatgtgtatgtagtttgtaaaaggagat 869
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 7657 taacggggactctggagagcaataagtatgtgtatgtgtatgtagtttgtaaaaggagat 7716
Query: 870 cggcgtacatccaaaatacacacatacacacac 902
|||||||||||||||||||||||||||||||||
Sbjct: 7717 cggcgtacatccaaaatacacacatacacacac 7749
\#
anon- EST:Posey247  = CG5119
>anon- EST:Posey247 
ggcacgagcg atatgtaatt tttttcaatt cttttttctc aaattcaaac tttaagaaag
ctttgtttag aaaaagaaac gcgacaacca tacactttta aaaaagcaaa gaaaaaacaa
aaaaattgca aaagagttaa aataaaaacg aaaaaatgga aagcaaactg tgcagagaac
agaagaatag aaagaaagaa agaaaaagaa aaccgccaga atatgagagt caagtttttg
ctactttgaa aaaagagaga aaatacagaa taccaacagc tgaaaaaata tgttgacaaa
tgaaaacaaa acataaatcg aaaaaactac aaaaaaatgg caaaacctat gttaaaacag
caaa
Database: dmel_all_transcript_r320
>CG5119-RG type=mRNA;
loc= 2R:join (13205133..13205406,13207147..13208631,
13208701..13209008,13209076..13209969); ID=pAbp-RG;
name=pAbp-RG; db_xref='CG5119,FlyBase:FBgn0003031';
len=2961
Length = 2961
Genome Map
Score = 150 bits (78), Expect = 6e-36
Identities = 85/92 (92%)
Strand = Plus / Plus
Query: 7 agcgatatgtaannnnnnncaattcttttttctcaaattcaaactttaagaaagctttgt 66
|||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 2607 agcgatatgtaatttttttcaattcttttttctcaaattcaaactttaagaaagctttgt 2666
Query: 67 ttagaaaaagaaacgcgacaaccatacacttt 98
||||||||||||||||||||||||||||||||
Sbjct: 2667 ttagaaaaagaaacgcgacaaccatacacttt 2698
Score = 127 bits (66), Expect = 6e-29
Identities = 68/69 (98%)
Strand = Plus / Plus
Query: 213 ccgccagaatatgagagtcaagtttttgctactttgaaaaaagagagaaaatacagaata 272
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2813 ccgcaagaatatgagagtcaagtttttgctactttgaaaaaagagagaaaatacagaata 2872
Query: 273 ccaacagct 281
|||||||||
Sbjct: 2873 ccaacagct 2881
\#
anon- EST:Posey249  = CG5119
>anon- EST:Posey249 
ggcacgagcg atatgtaatt tttttcaatt cttttttctc aaattcaaac tttaagaaag
ctttgtttag aaaaagaaac gcgacaacca tacactttta aaaaagcaaa gaaaaaacaa
aaaaattgca aaagagttaa aataaaaacg aaaaaatgga aagcaaactg tgcagagaac
agaagaatag aaagaaagaa agaaaaagaa aaccgcaaga atatgagagt caagtttttg
ctactttgaa aaaagagaga aaatacagaa taccaacagc tgaaaaaata tgttgacaaa
tgaaaacaaa acataaatcg aaaaaactac aaaaaaatgg caaaacctat gtaaaaacag
caaa
Database: dmel_all_transcript_r320
>CG5119-RG type=mRNA;
loc= 2R:join (13205133..13205406,13207147..13208631,
13208701..13209008,13209076..13209969); ID=pAbp-RG;
name=pAbp-RG; db_xref='CG5119,FlyBase:FBgn0003031';
len=2961
Length = 2961
Genome Map
Score = 150 bits (78), Expect = 6e-36
Identities = 85/92 (92%)
Strand = Plus / Plus
Query: 7 agcgatatgtaannnnnnncaattcttttttctcaaattcaaactttaagaaagctttgt 66
|||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 2607 agcgatatgtaatttttttcaattcttttttctcaaattcaaactttaagaaagctttgt 2666
Query: 67 ttagaaaaagaaacgcgacaaccatacacttt 98
||||||||||||||||||||||||||||||||
Sbjct: 2667 ttagaaaaagaaacgcgacaaccatacacttt 2698
Score = 133 bits (69), Expect = 1e-30
Identities = 69/69 (100%)
Strand = Plus / Plus
Query: 213 ccgcaagaatatgagagtcaagtttttgctactttgaaaaaagagagaaaatacagaata 272
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2813 ccgcaagaatatgagagtcaagtttttgctactttgaaaaaagagagaaaatacagaata 2872
Query: 273 ccaacagct 281
|||||||||
Sbjct: 2873 ccaacagct 2881
>CG5119-RD type=mRNA;
loc= 2R:join (13205087..13205150,13205226..13205406,
13207147..13208631,13208701..13209008,
13209076..13209969); ID=pAbp-RD; name=pAbp-RD;
db_xref='CG5119,FlyBase:FBgn0003031'; len=2932
Length = 2932
Genome Map
Score = 150 bits (78), Expect = 6e-36
Identities = 85/92 (92%)
Strand = Plus / Plus
Query: 7 agcgatatgtaannnnnnncaattcttttttctcaaattcaaactttaagaaagctttgt 66
|||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 2578 agcgatatgtaatttttttcaattcttttttctcaaattcaaactttaagaaagctttgt 2637
Query: 67 ttagaaaaagaaacgcgacaaccatacacttt 98
||||||||||||||||||||||||||||||||
Sbjct: 2638 ttagaaaaagaaacgcgacaaccatacacttt 2669
Score = 133 bits (69), Expect = 1e-30
Identities = 69/69 (100%)
Strand = Plus / Plus
Query: 213 ccgcaagaatatgagagtcaagtttttgctactttgaaaaaagagagaaaatacagaata 272
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2784 ccgcaagaatatgagagtcaagtttttgctactttgaaaaaagagagaaaatacagaata 2843
Query: 273 ccaacagct 281
|||||||||
Sbjct: 2844 ccaacagct 2852
\#
anon- EST:Posey25  = CG30185
>anon- EST:Posey25 
ggaacgaggt atttgttaaa aaccaaagcg aagctgatgc cgaaaagggt gaattattgg
caaccgtttc tatagtttta tctgaaacat gtatgaatgt tttatggctt aaaaactaag
tttcactgtc acagttaaac caaaaacaca actaaaaaaa actgttttag gtgatgaaac
tgcgacagca gacaatagaa acttaaaaac ctacacaact ttatgcttta agattaagtg
ggacaaacat tcacttgcca ccggcagtga atctcgtgcc gaattcggca cgaggtttct
tgcaatttcg cacgccaaat acaataactt taatttcgct gaccatgtgt gactttgcaa
cagtgcaaaa gatagccaac tgcctgggcg ttaatcccgg caaggtgcag ctgaatgagg
agcaggtcgt aacgcgcacg agtggccaaa agaagacgtg gccggattcg ccacgatcct
ggagagcctg gccagcgagt ccaagtcgga gaccgcccag aacagcaggg cgtcgcggga
ggtggaagcc caggtgtacc agtggatcga gttctccgtg ctctacgtgg cgcccaagga
caagtacgtg tccaagcagc ttctggcgga cttcaacaaa ctgtttgcca gcaaatccta
cctggtgggc cacttcatca ctctagccga cctggccgtc tactatgcca tctacgatct
tgtgaaatcc ctttcgccgg tggacaagga ggtatatttg aatctctccc gctggttcga
tcacctccag aatcgcgcgg atgtgcacca gggcgagcca ctgctgaact tcaccaccat
ctacctgcac ggctgggcca caggcaccca catctaagcc ccgggcgggc acccttgcat
ccattcacat ccagtcacga atgcgacact taagttattt atttctattg catttcacaa
tgtagttttg tgtgttgtga ttatcattta atgccaatga gagagttcag cgttggaata
tgaagaatcg ttattgtagc ccgcaaaaaa a
Database: dmel_all_transcript_r320
>CG30185-RA type=mRNA;
loc= 2R:join (18587609..18587747,18587816..18588121,
18588193..18588467); ID=CG30185-RA; name=CG30185-RA;
db_xref='CG30185,FlyBase:FBgn0050185'; len=720
Length = 720
Genome Map
Score = 1269 bits (660), Expect = 0.0
Identities = 698/712 (98%), Gaps = 7/712 (0%)
Strand = Plus / Plus
Query: 295 gtttcttgcaatttcgcacgccaaatacaataactttaatttcgctgaccatgtgtgact 354
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 9 gtttcttgcaatttcgcacgccaaacacaataactttaatttcgctgaccatgtgtgacg 68
Query: 355 ttgcaacagtgcaaaagatagccaactgcctgggcgttaatcccggcaaggtgcagctga 414
||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 69 ttgcaacagtgcagaagatagcaaactgcctgggcgttaatcccggcaaggtgcagctga 128
Query: 415 atgaggagcaggtcgtaacgcgcacgagtggccaaaagaaga-cgtggccggattcgcca 473
| ||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||
Sbjct: 129 acgaggagcaggtcgtaacgcgcacgagtgggcaaaagaagagcgtggccggattcgcct 188
Query: 474 cgatcctggagagcctggccagcgagtccaagtcggagaccgcccagaacagcagggcgt 533
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 189 cgatcctggagagcctggccagcgagtccaagtcggagaccgcccagaacagcagggcgt 248
Query: 534 cgcgggaggtggaagcccaggtgtaccagtggatcgagttctccgtgctctacgtggcgc 593
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 249 cgcgggaggtggaagcccaggtgtaccagtggatcgagttctccgtgctctacgtggcgc 308
Query: 594 cc------aaggacaagtacgtgtccaagcagcttctggcggacttcaacaaactgtttg 647
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 309 ccggctccaaggacaagtacgtgtccaagcagcttctggcggacttcaacaaactgtttg 368
Query: 648 ccagcaaatcctacctggtgggccacttcatcactctagccgacctggccgtctactatg 707
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 369 ccagcaaatcctacctggtgggccacttcatcactctagccgacctggccgtctactatg 428
Query: 708 ccatctacgatcttgtgaaatccctttcgccggtggacaaggaggtatatttgaatctct 767
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 429 ccatctacgatcttgtgaaatccctttcgccggtggacaaggaggtatatttgaatctct 488
Query: 768 cccgctggttcgatcacctccagaatcgcgcggatgtgcaccagggcgagccactgctga 827
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 489 cccgctggttcgatcacctccagaatcgcgcggatgtgcaccagggcgagccactgctga 548
Query: 828 acttcaccaccatctacctgcacggctgggccacaggcacccacatctaagccccgggcg 887
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 549 acttcaccaccatctacctgcacggctgggccacaggcacccacatctaagccccgggcg 608
Query: 888 ggcacccttgcatccattcacatccagtcacgaatgcgacacttaagttatttatttcta 947
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 609 ggcacccttgcatccattcacatccagtcacgaatgcgacacttaagttatttatttcta 668
Query: 948 ttgcatttcacaatgtagttttgtgtgttgtgattatcatttaatgccaatg 999
||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 669 ttgcatttcacaatgtagttttgtgtgttgtgattatcatttaatgccaatg 720
\#
anon- EST:Posey251  = ?
>anon- EST:Posey251 
ggcacgaggt ttgaattaaa tacagtaaag taaatcgaaa aaaaaacaca cttaaacaaa
atggagtcta tgtgtaaatg cattataatt agaattgcag taaaccatac aaacagaggc
gaaacgaaat ttaaataaaa tttttaacat tccaatgatg ctatttcttt ggtgtgctgt
tttaaacaac aaaaa
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003726 |gb|AE003726| arm:3R  15173357..15421232
estimated- cyto:92A2-92A10  gadfly- seqname:AE003726 
 seq_release:3 
Length = 247876
Score = 321 bits (167), Expect = 3e-87 Genome Map
Identities = 176/185 (95%)
Strand = Plus / Plus
Query: 9 gtttgaattaaatacagtaaagtaaatcgnnnnnnnnncacacttaaacaaaatggagtc 68
||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 112508 gtttgaattaaatacagtaaagtaaatcgaaaaaaaaacacacttaaacaaaatggagtc
112567
Query: 69 tatgtgtaaatgcattataattagaattgcagtaaaccatacaaacagaggcgaaacgaa 128
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 112568 tatgtgtaaatgcattataattagaattgcagtaaaccatacaaacagaggcgaaacgaa
112627
Query: 129 atttaaataaaatttttaacattccaatgatgctatttctttggtgtgctgttttaaaca 188
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 112628 atttaaataaaatttttaacattccaatgatgctatttctttggtgtgctgttttaaaca
112687
Query: 189 acaaa 193
|||||
Sbjct: 112688 acaaa 112692
\#
anon- EST:Posey259  =CG8177
>anon- EST:Posey259 
ggcacgagct cgtgccgaat tcggcacgag gagcgtcaca caatgattgc atcacacgca
aaagaaacca acgagcggaa caagttatta actcggttgg agactcgcat gtattattag
caataattgc atttgcatat acacaaaact attataaatt tggcttagac ctatcaaatc
gaagcaatcc cagcgtggaa aactaagagg aacccgtaaa ctatttaact tcaactggcg
tagtgataat tagtgtcaaa cacacacaaa aacctcccct ttaagatcga acgaacaatt
gtttataaca aaaaaatcgt tttaagcact tcaaccggag ctttctttta aagtaaatgc
ttcgcgtttg aagtggccgc tgtaagtttg ccttctttgt acttgtagtc nggatattga
aaaacaacca aa
Database: dmel_all_transcript_r320
>CG8177-RE type=mRNA;
loc= 3L:join (9731802..9732018,9736975..9737122,
9737181..9737436,9737652..9737781,9738065..9738226,
9738295..9738537,9738607..9738747,9739232..9739432,
9740138..9740332,9740403..9742156,9742226..9742420,
9742481..9742709,9742771..9743794); ID=CG8177-RE;
name=CG8177-RE; db_xref='CG8177,FlyBase:FBgn0036043';
len=4895
Length = 4895
Genome Map
Score = 740 bits (385), Expect = 0.0
Identities = 395/404 (97%)
Strand = Plus / Plus
Query: 29 aggagcgtcacacaatgattgcatcacacgcaaaagaaaccaacgagcggaacaagttat 88
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4470 aggagcgtcacacaatgattgcatcacacgcaaaagaaaccaacgagcggaacaagttat 4529
Query: 89 taactcggttggagactcgcatgtattattagcaataattgcatttgcatatacacaaaa 148
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4530 taactcggttggagactcgcatgtattattagcaataattgcatttgcatatacacaaaa 4589
Query: 149 ctattataaatttggcttagacctatcaaatcgaagcaatcccagcgtggaaaactaaga 208
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4590 ctattataaatttggcttagacctatcaaatcgaagcaatcccagcgtggaaaactaaga 4649
Query: 209 ggaacccgtaaactatttaacttcaactggcgtagtgataattagtgtcaaacacacaca 268
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4650 ggaacccgtaaactatttaacttcaactggcgtagtgataattagtgtcaaacacacaca 4709
Query: 269 aaaacctcccctttaagatcgaacgaacaattgtttataacnnnnnnntcgttttaagca 328
||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 4710 aaaacctcccctttaagatcgaacgaacaattgtttataacaaaaaaatcgttttaagca 4769
Query: 329 cttcaaccggagctttcttttaaagtaaatgcttcgcgtttgaagtggccgctgtaagtt 388
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4770 cttcaaccggagctttcttttaaagtaaatgcttcgcgtttgaagtggccgctgtaagtt 4829
Query: 389 tgccttctttgtacttgtagtcnggatattgaaaaacaaccaaa 432
|||||||||||||||||||||| ||||||||||||||||| |||
Sbjct: 4830 tgccttctttgtacttgtagtcaggatattgaaaaacaacaaaa 4873
\#
anon- EST:Posey262  = CG15209
>anon- EST:Posey262 
ggcacgaggg atgacccatg cagatataca tactatggca actatatgat attctccgac
ctgactttcg ttagaacatt ataaggagca ttgtagttcc agcagcaatt ctttcaaata
atagtttgcc tcatttttag actcgtatag aaatgcaaat aaactaaacc gtattattgt
aaaaa
Database: dmel_all_transcript_r320
>CG15209-RA type=mRNA; loc= X:10584094..10584942 ; ID=CG15209-RA; Genome Map
name=CG15209-RA; db_xref='CG15209,FlyBase:FBgn0030237';
len=849
Length = 849
Score = 323 bits (168), Expect = 3e-88
Identities = 172/174 (98%)
Strand = Plus / Plus
Query: 8 gggatgacccatgcagatatacatactatggcaactatatgatattctccgacctgactt 67
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 669 gggatgacccatgcagatatacatactatggcaactatatgatattctccgacctgactt 728
Query: 68 tcgttagaacattataaggagcattgtagttccagcagcaattctttcaaataatagttt 127
|| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 729 tctttagaacattataaggagcattgtaattccagcagcaattctttcaaataatagttt 788
Query: 128 gcctcatttttagactcgtatagaaatgcaaataaactaaaccgtattattgta 181
||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 789 gcctcatttttagactcgtatagaaatgcaaataaactaaaccgtattattgta 842
\#
anon- EST:Posey263  = ? end of l(3)82Fd ?
>anon- EST:Posey263 
ggcacgaggt aagaccctcc ctaagcacgc attaaaccaa atccaaatca agttgaatcc
ctgttgtatt gtgaaaacgg aagacattat tttgaggaat tttgagagca aaagctatga
taaccggaaa tcgaaagatc atttagcttt gaaatcactt caactacacg ctaacttcat
tcaaaaactt gagaccaaaa tacgtttact acaatatatg gcatatacat atggcactac
agagtggcaa caactctacg gttggagcat gatatcatta aatattatcg atacgtatac
cgcagaatag tttgttgaca accagtcaat tatgtcccaa acaaaactca ctcacgcgag
ctaaaagctt aatggaatac atatgtattg tatatgaagt caagaagtgt ttatttccgt
agactatgaa actatgttgt tgaattcgta gctattttgt tgtgcgttga gcagtaatgc
agtgaatatg caagccatat gaagccgaaa ttaatgaaga taattttata ttgtaacttc
tgtcaattaa attgtagact ggtgcatata ccaagcgaaa ctgcgtaaca tatgccgcat
acatacatat gtatagctgt tgcagcaggc acttgtttaa gccatcaatg catggtttat
tgatgacgaa ctatagttct gctcccccaa attttgttgt gcgttcaata agtgcttagt
attggtgtaa tatataattc aggcagacat acaaacataa gtacccagat gtatatcaca
gccagttaat cagttagtgt gcaattatcc cagcccatgc gagtactttt tgcactcagt
gtccgcattt ccagtgcgct tgcccattac agtgttgagt agtttgctaa agtttctagt
tgttgtgcac tgaaaataaa cacaatgtaa ttcgcacaat tcgcggcaga tattcggcca
ggtatgcttc agatatgcat ataatataca catacatatg taccccttct tagagataga
tttgcgattg ttaggtgctg aagacgacct ccgctttttc agttcgaccc tgtagaatgc
tgattgtaga accgcgcgat tgtataaact ccacgtagaa gggagcaaca ctctatctat
ccaggccaca acttaatgtc catgccacat gccacacatg tatgttaagt gggtgactgg
cgagaggaa ggattttaca aaggatacag ataaatcgat cggagattga ggcagttgga
tgtggatgca gcaggtggtt tatttttcta ccgacagatt gcaagcaatt gagaacatag
ttgattacta gacgaacagc agccattacc taagtcgtgt gtatatatac gagaggcata
tatctaccta aatgcataca tatatagtat atatatatat ttttggaaag cgaatctagt
gtgtctcgat gatatcggct agctgtattc aggtcgcggc caagtactaa gcatatttgc
aaggatagtg atcagattaa atgttaaaac taattcgaga gttaaaaagt tcaccttggt
tttttggttt gaatggaatg cattcgttgt tttttggtta ttctaaacac ggattaattc
ctgtgtgcaa cttgtatcgt acctataaaa ttgcattcca acaaaaacaa aaacccatga
gcagaacgca agagtatata tataaatata tcctatatgt aaatgtagtc attacaaaaa
tgaacaactt ttctgaaaaa taaaatgtat attcaaatat caaaaa
Database: dmel_all_scaffolds_r310
gadfly| SEG:AE003603 |gb|AE003603| arm:3R  971101..1266389
estimated- cyto:82F1-83A3  gadfly- seqname:AE003603 
 seq_release:3 
Length = 295289
Score = 2732 bits (1421), Expect = 0.0 Genome Map
Identities = 1488/1539 (96%), Gaps = 3/1539 (0%)
Strand = Plus / Minus
Query: 247 gcaacaactctacggttggagcatgatatcattaaatattatcgatacgtataccgcaga 306
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 126271 gcaacaactctacggttggagcatgatatcattaaatattatcgatacgtataccgcaga
126212
Query: 307 atagtttgttgacaaccagtcaattatgtcccaaacaaaactcactcacgcgagctaaaa 366
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 126211 atagtttgttgacaaccagtcaattatgtcccaaacaaaactcactcacgcgagctaaaa
126152
Query: 367 gcttaatggaatacatatgtattgtatatgaagtcaagaagtgtttatttccgtagacta 426
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 126151 gcttaatggaatacatatgtattgtatatgaagtcaagaagtgtttatttccgtagacta
126092
Query: 427 tgaaactatgttgttgaattcgtagctattttgttgtgcgttgagcagtaatgcagtgaa 486
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 126091 tgaaactatgttgttgaattcgtagctattttgttgtgcgttgagcagtaatgcagtgaa
126032
Query: 487 tatgcaagccatatgaagccgaaattaatgaagataattttatattgtaacttctgtcaa 546
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 126031 tatgcaagccatatgaagccgaaattaatggagataattttatattgtaacttctgtcaa
125972
Query: 547 ttaaattgtagactggtgcatataccaagcgaaactgcgtaacatatgccgcatacatac 606
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 125971 ttaaattgtagactggtgcatataccaagcgaaactgcgtaacatatgccgcatacatac
125912
Query: 607 atatgtatagctgttgcagcaggcacttgtttaagccatcaatgcatggtttattgatga 666
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 125911 atatgtatagctgttgcagcaggcacttgtttaagccatcaatgcatggtttattgatga
125852
Query: 667 cgaactatagttctgctcccccaaattttgttgtgcgttcaataagtgcttagtattggt 726
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 125851 cgaactatagttctgctcccccaaattttgttgtgcgttcaataagtgcttagtattggt
125792
Query: 727 gtaatatataattcaggcagacatacaaacataagtacccagatgtatatcacagccagt 786
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 125791 gtaatatataattcaggcagacatacaaacataagtacccagatgtatatcacagccagt
125732
Query: 787 taatcagttagtgtgcaattatcccagcccatgcgagtactttttgcactcagtgtccgc 846
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 125731 taatcagttagtgtgcaattatcccagcccatgcgagtactttttgcactcagtgtccgc
125672
Query: 847 atttccagtgcgcttgcccattacagtgttgagtagtttgctaaagtttctagttgttgt 906
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 125671 atttccagtgcgcttgcccattacagtgttgagtagtttgccaaagtttctagttgttgt
125612
Query: 907 gcactgaaaataaacacaatgtaattcgcacaattcgcggcagatattcggccaggtatg 966
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 125611 gcactgaaaataaacacaatgtaattcgcacaattcgcggcagatattcggccaggtatg
125552
Query: 967 cttcagatatgcatataatatacacatacatatgtaccccttcttagagatagatttgcg 1026
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 125551 cttcagatatgcatataatatacacatacatatgtaccccttcttagagatagatttgcg
125492
Query: 1027 attgttaggtgctgaagacgacctccgctttttcagttcgaccctgtagaatgctgattg 1086
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 125491 attgttaggtgctgaagacgacctccgctttttcagttcgaccctgtagaatgctgattg
125432
Query: 1087 tagaaccgcgcgattgtataaactccacgtagaagggagcaacactctatctatccaggc 1146
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 125431 tagaaccgcgcgattgtataaactccacgtagaagggagcaccactctatctatccaggc
125372
Query: 1147 cacaacttaatgtccatgccacatgccacacatgtatgttaagtgggtgactgg-cgaga 1205
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 125371 cacaacttaatgtccatgccacatgccacacatgtatgttaagtgggtgactggacgaga
125312
Query: 1206 ggaaggattttacaaaggatacagataaatcgatcggagattgaggcagttggatgtgga 1265
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 125311 ggaaggattttacaaaggatacagataaatcgatcggagattgaggcagttggatgtgga
125252
Query: 1266 tgcagcaggtggtttatttttctaccgacagattgcaagcaattgagaacatagttgatt 1325
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 125251 tgcagcaggtggtttatttttctaccgacagattgcaagcaattgagaacatagttgatt
125192
Query: 1326 actagacgaacagcagccattacctaagtcgtgtgtatatatacgagaggcatatatcta 1385
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 125191 actagacgaacagcagccattacctaagtcgtgtgtatatatacgagaggcatatatcta
125132
Query: 1386 cctaaatgcatacnnnnnnnnnnnnnnnnnnnnnttttggaaagcgaatctagtgtgtct 1445
||||||||||||| ||||||||||||||||||||||||||
Sbjct: 125131 cctaaatgcatacatatatagtatatatatatatttttggaaagcgaatctagtgtgtct
125072
Query: 1446 cgatgatatcggctagctgtattcaggtcgcggccaagtactaagcatatttgcaaggat 1505
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 125071 cgatgatatcggctagctgtattcaggtcgcggccaagtactaagcatatttgcaaggat
125012
Query: 1506 agtgatcagattaaatgttaaaactaattcgagagttaaaaagttcaccttggttttttg 1565
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 125011 agtgatcagattaaatgttaaaactaattcgagagttaaaaagttcaccttggttttttg
124952
Query: 1566 gtttgaatggaatgcattcgttgttttttggttattctaaacacggattaattcctgtgt 1625
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 124951 gtttgaatggaatgcattcgttgttttttggttattctaaacacggattaattcctgtgt
124892
Query: 1626 gcaacttgtatcgtacctataaaattgcattccaacaaaaacaaaaacccatgagcagaa 1685
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 124891 gcaacttgtatcgtacctataaaattgcattccaacaaaaacaaaaacccatgagcagaa
124832
Query: 1686 cgcaagagnnnnnnnnnnnnnnnnnnnnnnnngtaaatgt--agtcattacaaaaatgaa 1743
|||||||| |||||||| ||||||||||||||||||
Sbjct: 124831 cgcaagagtatatatataaatatatcctatatgtaaatgtaaagtcattacaaaaatgaa
124772
Query: 1744 caacttttctgaaaaataaaatgtatattcaaatatcaa 1782
|||||||||||||||||||||||||||||||||||||||
Sbjct: 124771 caacttttctgaaaaataaaatgtatattcaaatatcaa 124733
\#
anon- EST:Posey264  = not in genome, and a pretty odd seq
>anon- EST:Posey264 
ggcacgagag agaagagaag agaagagaag agaagagaag agaagagaag agaagagaag
agaagagaag agaagagaag agaagagaag agaagagaag agaagagaag agaaaaa
\#
anon- EST:Posey268  = ?
>anon- EST:Posey268 
ggcacgagtc gaaacccact taatttattt gcatttggcg acattgacgg tagactattc
agcgcgaaac tccaacatcc gttaggagtg actttcaatg ataccaataa caaactctat
gttgctgata cctataatca taaaatcaaa attattgaca tcgattcaaa tgatatatct
actctacaaa ttaagagcca agaaaatact aacctgattt taaacgagcc cgccggactg
tgcttggatg ccagcggacg gaatttgttg gtagctgata ccaataacca ttcaatacat
acaatagatt tggtaacgct tatagcacaa ccgtttggct tagatttcag acaaatagcg
tccgctagtg aaattgatgc gccacaagat acacaaaagc ctacggaaaa taatatagtt
aaagcattgc ctcttgattt aattaaacca agtaaaattt tttttaacct tcggctttcg
cccagattta actttacaaa ggaagctcct caaaaatgga tagtgaaaac tgtatgtcaa
tctgtaatag taaatccaac gtgcggaaat ctacttgatg ggatgtgcca catgcaggtg
caggctacta ggcctgattt tatgtgtgaa agcagtcaaa tatttaccat cgaattcgta
ttaaatttat gcctttcaaa ttgttgccta gtaaaaaaaa tcacggtttc tataaaacgc
gatgacatac aagaagaata tatatccatc cacaacgtaa atattgacat tgaacaataa
aaaatgtttt gatagaaaaa
Database: dmel_all_scaffolds_r310
>gadfly| SEG:2R_wgs3_centromere_extension |gb|2R_wgs3_centromere_extension|a
 rm:2h  1296910,1651714 estimated-cyto:?
gadfly- seqname:2R_wgs3_centromere_extension   seq_release:3 
Length = 354805
Score = 1435 bits (746), Expect = 0.0 Genome Map
Identities = 762/778 (97%)
Strand = Plus / Minus
Query: 22 aatttatttgcatttggcgacattgacggtagactattcagcgcgaaactccaacatccg 81
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 280727 aatttatttgcatttggcgacattgacggtagactattcagcgcgaaactccaacatccg
280668
Query: 82 ttaggagtgactttcaatgataccaataacaaactctatgttgctgatacctataatcat 141
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 280667 ttaggagtgactttcaatgataccaataacaaactctatgttgctgatacctataatcat
280608
Query: 142 aaaatcaaaattattgacatcgattcaaatgatatatctactctacaaattaagagccaa 201
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 280607 aaaatcaaaattattgacatcgattcaaatgatatatctactctacaaattaagagccaa
280548
Query: 202 gaaaatactaacctgattttaaacgagcccgccggactgtgcttggatgccagcggacgg 261
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 280547 gaaaatactaacctgattttaaacgagcccgccggactgtgcttggatgccagcggacgg
280488
Query: 262 aatttgttggtagctgataccaataaccattcaatacatacaatagatttggtaacgctt 321
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 280487 aatttgttggtagctgataccaataaccattcaatacatacaatagatttggtaacgctt
280428
Query: 322 atagcacaaccgtttggcttagatttcagacaaatagcgtccgctagtgaaattgatgcg 381
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 280427 atagcacaaccgtttggcttagatttcagacaaatagcgtccgctagtgaaattgatgcg
280368
Query: 382 ccacaagatacacaaaagcctacggaaaataatatagttaaagcattgcctcttgattta 441
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 280367 ccacaagatacacaaaagcctacggaaaataatatagttaaagcattgcctcttgattta
280308
Query: 442 attaaaccaagtaaaannnnnnnnaaccttcggctttcgcccagatttaactttacaaag 501
|||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 280307 attaaaccaagtaaaattttttttaaccttcggctttcgcccagatttaactttacaaag
280248
Query: 502 gaagctcctcaaaaatggatagtgaaaactgtatgtcaatctgtaatagtaaatccaacg 561
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 280247 gaagctcctcaaaaatggatagtgaaaactgtatgtcaatctgtaatagtaaatccaacg
280188
Query: 562 tgcggaaatctacttgatgggatgtgccacatgcaggtgcaggctactaggcctgatttt 621
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 280187 tgcggaaatctacttgatgggatgtgccacatgcaggtgcaggctactaggcctgatttt
280128
Query: 622 atgtgtgaaagcagtcaaatatttaccatcgaattcgtattaaatttatgcctttcaaat 681
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 280127 atgtgtgaaagcagtcaaatatttaccatcgaattcgtattaaatttatgcctttcaaat
280068
Query: 682 tgttgcctagtnnnnnnnntcacggtttctataaaacgcgatgacatacaagaagaatat 741
||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 280067 tgttgcctagtaaaaaaaatcacggtttctataaaacgcgatgacatacaagaagaatat
280008
Query: 742 atatccatccacaacgtaaatattgacattgaacaataaaaaatgttttgatagaaaa 799
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 280007 atatccatccacaacgtaaatattgacattgaacaataaaaaatgttttgatagaaaa 279950
Score = 33.4 bits (17), Expect = 9.0 Genome Map
Identities = 21/23 (91%)
Strand = Plus / Minus
Query: 406 gaaaataatatagttaaagcatt 428
||||||| ||| |||||||||||
Sbjct: 95737 gaaaatattattgttaaagcatt 95715
\#
anon- EST:Posey277  = CG31451
>anon- EST:Posey277 
ggcacgaggt cgagtgcgga tcccttgccc cagcggctat tcgcctgcgc actcggtcca
tccctggctc actacacgaa gcgacggcgt ggcccagttg ggtgcgggaa tagccggatc
tggccttaaa aaccggataa accattgagc gcgggacgca ctcggctgta ggtacgccgc
ccaaacaagg tcacaccgag agacacacgt ccacgaacag accagagttc ttcccgcaat
ccatcagaca cgcactgcca tggaaaggtc acggaaatcg catggcagtg ctcaccaaaa
tccaaatcca agcccaatcc gtccctggtc ccgccccttg cgaatccgct tgcggaattg
tgggggtggg gtgtggggcg gctgggtggg agtttgatca taacacaaac acgaaaccaa
accaaacacc accacccttt gcgttcggca aatcacctcc ggctgcgatt aaggggctca
gtgccagggg ttagtcggag cacactcgac cgatttccgt gacatacgtc tctagccaaa
tccggcagag atcggagggc gcgcccgacg ccaccagtcg tgggctatgc aatggattga
acgaaacatg cgccagagcc aatttttata tttgaccatt aagaaaaacc tatgattttg
ctttactatt cgacccacta tcatcccaga ttgcgtagcc tccggcgtcc ttggcgacgc
ggcgtcgtcg tccggaccat cctccggcac gccttccaaa attggcgttc actggatcga
ttagccccca gcaaattgaa tcgcagcccg caggagattt ggttattatc gcctcatttc
gtacaaagag aaaccgcaac aaggaaacac tgcacatcgt tttttacacc cttgcgttat
gttttttgaa tgtatttaaa aacaaaaaca aaatgaaaaa ccaaaaccaa ataatgaaaa
acaaaatatg aaaacacaca aaacactgaa aaaaaaaacc aaaaatagaa tgtaagttta
aataatatgc tattcaaaga aatccaaaac atgattaccc ataaaacaaa aa
Database: dmel_all_transcript_r320
>CG31451-RA type=mRNA; loc= 3R:19799725..19800949 ; ID=CG31451-RA; Genome Map
name=CG31451-RA; db_xref='CG31451,FlyBase:FBgn0051451';
len=1225
Length = 1225
Score = 985 bits (512), Expect = 0.0
Identities = 522/527 (99%)
Strand = Plus / Plus
Query: 391 agtttgatcataacacaaacacgaaaccaaaccaaacaccaccaccctttgcgttcggca 450
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 544 agtttgatcataacacaaacacgaaaccaaaccaaacaccaccaccctttgcgttcggca 603
Query: 451 aatcacctccggctgcgattaaggggctcagtgccaggggttagtcggagcacactcgac 510
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 604 aatcacctccggctgcgattaaggggctcagtgccaggggttaatcggagcacactcgac 663
Query: 511 cgatttccgtgacatacgtctctagccaaatccggcagagatcggagggcgcgcccgacg 570
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 664 cgatttccgtgacatacgtctctagccaaatgcggcagagatcggagggcgcgcccgacg 723
Query: 571 ccaccagtcgtgggctatgcaatggattgaacgaaacatgcgccagagccaatttttata 630
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 724 ccaccagtcgtgggctatgcaatggattgaacgaaacatgcgccagagccaatttttata 783
Query: 631 tttgaccattaagaaaaacctatgattttgctttactattcgacccactatcatcccaga 690
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 784 tttgaccattaagaaaaacctatgattttgctttacgattcgacccactatcatcccaga 843
Query: 691 ttgcgtagcctccggcgtccttggcgacgcggcgtcgtcgtccggaccatcctccggcac 750
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 844 ttgcgtagcctccggcgtccttggcgacgcgacgtcgtcgtccggaccatcctccagcac 903
Query: 751 gccttccaaaattggcgttcactggatcgattagcccccagcaaattgaatcgcagcccg 810
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 904 gccttccaaaattggcgttcactggatcgattagcccccagcaaattgaatcgcagcccg 963
Query: 811 caggagatttggttattatcgcctcatttcgtacaaagagaaaccgcaacaaggaaacac 870
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 964 caggagatttggttattatcgcctcatttcgtacaaagagaaaccgcaacaaggaaacac 1023
Query: 871 tgcacatcgttttttacacccttgcgttatgttttttgaatgtattt 917
|||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1024 tgcacatcgttttttacacccttgcgttatgttttttgaatgtattt 1070
\#
anon- EST:Posey280  = ?
>anon- EST:Posey280 
ggcacgaggg gaagtagcat atccattcta aacccacaac tcctcaatca cacacactat
tgtaaacaat aacacacaca ataatgccta agtgcgaaat gtaatcaacg gtcgagagcc
cttcgattaa gctcattgct catttacgca gagcaaagtg caaaagtccg aagtccaaaa
tccagactct gtggcgagcc aacgtccacg tcccctaaac atccgatttt tacgacttta
ttctcttaaa cttcgctctt aagctatccc aatctgccta tataaaccca aacatgtccc
catatagtag ttcagttctg ggtacgttat caatcgcgat aaccctgctn agcccacttc
aacttcgaag tccattatct acctagtgat aatccaaagg gcctagctct tcctttattg
gaattaaaaa gaaaacgttt aataatacat aa
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003788 |gb|AE003788| arm:2R  1..217015
estimated- cyto:41E3-41E5  gadfly- seqname:AE003788 
 seq_release:3 
Length = 217015
Score = 285 bits (148), Expect = 8e-76 Genome Map
Identities = 205/224 (91%), Gaps = 8/224 (3%)
Strand = Plus / Plus
Query: 235 actttattctcttaaacttcgctcttaagctatcccaatctgcctatataaacccaaaca 294
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 179821 actttattatcttaaacttcgctcttaagctatcccaatctgcctatataaacccaaaca
179880
Query: 295 tgtccccata---tagt--agttcagttctgggtacgttatcaatcgcgataaccctgct 349
|||||||||| |||| |||||||||||| ||||||||||||||||||||||||||||
Sbjct: 179881 tgtccccatacactagttcagttcagttctgagtacgttatcaatcgcgataaccctgct
179940
Query: 350 nagcccacttcaacttcgaagtccattatcta-cctagtgataatccaaagggcctagct 408
|||||||||||| |||||||||| ||||| | ||||||||||||||||||| |||| |
Sbjct: 179941 aagcccacttcaatttcgaagtccgttatccagcctagtgataatccaaaggctctagtt
180000
Query: 409 cttcctttattggaattaaaaagaaaacgtttaataatacataa 452
||||||||||||||||||| | |||||||| ||||||||||||
Sbjct: 180001 cttcctttattggaattaata--aaaacgttaaataatacataa 180042
Score = 117 bits (61), Expect = 2e-25 Genome Map
Identities = 71/76 (93%)
Strand = Plus / Plus
Query: 152 agcaaagtgcaaaagtccgaagtccaaaatccagactctgtggcgagccaacgtccacgt 211
|||||||||||||||||||||||||||| | |||||||||||||| |||||||||||||
Sbjct: 179605 agcaaagtgcaaaagtccgaagtccaaagtgtagactctgtggcgacccaacgtccacgt
179664
Query: 212 cccctaaacatccgat 227
|||||||| |||||||
Sbjct: 179665 cccctaaaaatccgat 179680
\#
anon- EST:Posey285  = CG6869
>anon- EST:Posey285 
ggcacgaggt gccgaccatt gtaacatata caataccaga tgcataagag aacgtagaaa
cctagtctag ttatatatgg atatacaagt gctatgtata catagttcgg taatttatat
agttgtttaa actaaaagca agtccaaaat agaccgtaat gagtaaatga aaggcaagtt
aaagtagttc aacwttaaaa ggcttaactc aaatgagagg aggcatccag ctatatagat
tagatctttt gtaagtgttt ttgtaagcaa ccagcaaaca acacaatggc ttgacctgaa
ataagttgcc tgttattaga ggcgcacttt cttttccagg tttattttct gttttaggct
ctatctagac cggcttttag ttgaaatatt agctgttgag agctacttgt aaaggtttcc
cagcctgttg actaactact aactttataa ccgattcgca caagccaaca tatgtatwtc
taatataaat acaaatacaa tctgcattcc tatttttcat gaaatatcat atggcgtatt
attttagttc gaacagcgca atgtgtgtgt tttttacaat ttttatcaat atttgtattt
attgtataac attttattta taagtattga ataatatcat a
Database: dmel_all_transcript_r320
>CG6869-RA type=mRNA;
loc= 3L:join (15096019..15096281,15099691..15099880,
15100347..15101063,15101249..15101432,
15101499..15103276); ID=FucTA-RA; name=FucTA-RA;
db_xref='CG6869,FlyBase:FBgn0036485'; len=3132
Length = 3132
Genome Map
Score = 1092 bits (567), Expect = 0.0
Identities = 617/634 (97%), Gaps = 6/634 (0%)
Strand = Plus / Plus
Query: 9 gtgccgaccattgtaacatatacaataccagatgcataagagaacgtagaaacctagtct 68
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2405 gtgccgaccattgtaacatatacaataccagatgcataagagaacgtagaaacctagtct 2464
Query: 69 agttatatatggatatacaagtgctatgtatacatagttcggtaatttatatagttgttt 128
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2465 agatatatatggatatacaagtgctatgtatacatagttcggtaatttatatagttgttt 2524
Query: 129 aaactaaaagcaagtccaaaatagaccgtaatgagtaaatgaaaggcaagttaaagtagt 188
|||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||
Sbjct: 2525 aaactaaaagcaagtccaaaatagaccgtaatgattaaatgacaggcaagttaaagtagt 2584
Query: 189 tcaacwttaaaaggcttaactcaaatgagaggaggcatccagctatatagattagatctt 248
||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 2585 tcaacattaaaaggcttaactcaaatgagaggaggcatc-agctatatagattagatctt 2643
Query: 249 ttgtaagtgtttttgtaagcaaccagcaaacaacacaatggcttgacctgaaataagttg 308
|||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||
Sbjct: 2644 ttgtaagtgtttttgtaagcaaccagcaaaca---caatggctcgacctgaaataagttg 2700
Query: 309 cctgttattagaggcgcactttcttttccaggttta-ttttctgttttaggctctatcta 367
||||||||||||| |||||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 2701 cctgttattagag-cgcactttcttttccaggtttaattttctgtattaggctctatcta 2759
Query: 368 gaccggcttttagttgaaatattagctgttgagagctacttgtaaaggtttcccagcctg 427
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2760 gaccggcttttagttgaaatattagctgttgagagctacttgtaaaggtttcccagcctg 2819
Query: 428 ttgactaactactaactttataaccgattcgcacaagccaacatatgtatwtctaatata 487
||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |||||
Sbjct: 2820 ttgactaactactaactttataaccgattcgcacaagcctacatatgtatatctgatata 2879
Query: 488 aatacaaatacaatctgcattcctatttttcatgaaatatcatatggcgtattattttag 547
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 2880 aatacaaatacaatctgcattcctatttttcatgaaatatcatatggcgtattatcttag 2939
Query: 548 ttcgaacagcgcaatgtgtgtgttttttacaatttttatcaatatttgtatttattgtat 607
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 2940 ttcgaacagcgcaatgtgtgtgttttttacaatttttatcaatatttgtatttattgtgt 2999
Query: 608 aacattttatttataagtattgaataatatcata 641
||||||||||||||||||||||||||||||||||
Sbjct: 3000 aacattttatttataagtattgaataatatcata 3033
\#
anon- EST:Posey288  = CG13993
>anon- EST:Posey288 
ggtgttgcaa ttttcagtga attcgcagca gagccaagca atttgcattc aatcatctgt
gaaggaaaag ctatcacaca aaatggcaca aatggacatc gaattgaaga aggccttcac
cgagatgcag atcantgagc tggagacgac caagaagatc cacatgatcg acatgaagtg
cgacgtggtc aagacaggca aacaaaagta ccagctgaca gaaaagggca cctgctgctt
ggccgacgac acaagaattt accagtccgt gggtcgcatg ttcctgctta ccgatttaca
gaatatgcgc gaggacctga aggctaggcn ggaaaaatgc gacaaagcga tngaactgct
ggagaagaag aaggantctt gcagaagtcc ttaaaaacca ggaagacgtc tgcgctagtt
ggtgcaccnc cgcagggaac ccatcagacn gcgaaataga ctaccctccg aactggcttt
ntccctca
Database: dmel_all_transcript_r320
>CG13993-RA type=mRNA;
loc= 2L:join (6061318..6061465,6061562..6061704,
6061774..6062055); ID=CG13993-RA; name=CG13993-RA;
db_xref='CG13993,FlyBase:FBgn0031776'; len=573
Length = 573
Genome Map
Score = 733 bits (381), Expect = 0.0
Identities = 464/494 (93%), Gaps = 6/494 (1%)
Strand = Plus / Plus
Query: 1 ggtgttgcaattttcagtgaattcgcagcagagccaagcaatttgcattcaatcatctgt 60
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 37 ggtgttgcaattttcagtgaattcgcagcaaagccaagcaatttgcattcaatcatctgt 96
Query: 61 gaaggaaaagctatcacacaaaatggcacaaatggacatcgaattgaagaaggccttcac 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 97 gaaggaaaagctatcacacaaaatggcacaaatggacatcgaattgaagaaggccttcac 156
Query: 121 cgagatgcagatcantgagctggagacgaccaagaagatccacatgatcgacatgaagtg 180
|||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 157 cgagatgcagatcaataagctggagacgaccaagaagatccacatgatcgacatgaagtg 216
Query: 181 cgacgtggtcaagacaggcaaacaaaagtaccagctgacagaaaagggcacctgctgctt 240
|||| ||||||||||||||||||||||||||||||||||||||||||||||| || ||||
Sbjct: 217 cgacatggtcaagacaggcaaacaaaagtaccagctgacagaaaagggcaccagcagctt 276
Query: 241 ggccgacgacacaagaatttaccagtccgtgggtcgcatgttcctgcttaccgatttaca 300
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 277 ggccgacgacacaagagtttaccagtccgtgggtcgcatgttcctgcttaccgatgtaca 336
Query: 301 gaatatgcgcgaggacctgaaggctaggcnggaaaaatgcgacaaagcgatngaactgct 360
||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||||
Sbjct: 337 gaatatgcgcgaggacctgaaggctaggcaggagaaatgcgacaaagcgatagaactgct 396
Query: 361 ggagaagaagaagga-ntcttgcagaagt-ccttaaaaaccaggaagac-gtctgcgcta 417
||||||||||||||| |||||||||||| |||||| | |||||||||| |||||||| |
Sbjct: 397 ggagaagaagaaggagttcttgcagaagtcccttaagagccaggaagacggtctgcgcga 456
Query: 418 gttggtgcaccnccgcagggaa-cccatcagacngcgaaatagactac-cctccgaactg 475
||||||||| | |||| |||| || ||||||| |||||||||||||| |||| |||||
Sbjct: 457 gttggtgcagcagcgcaaggaagccgatcagactgcgaaatagactacaactccaaactg 516
Query: 476 gc-tttntccctca 488
|| ||| |||||||
Sbjct: 517 gcatttatccctca 530
\#
anon- EST:Posey289  = end of lace ?
>anon- EST:Posey289 
ggcacgagat tcactgtacg ggattcttaa gtctactagt gtaaatattt atttaaaata
tataaaactt ggcgggcaga tgaatcttaa agtcgaaaaa tgttttgcct tgtattttac
ataaattttg acacaactta tgcgacctct acagttaatt tacagaagtt ggatactcga
cgcaaatata aaacacatat gtagagaatc cgctaagtct agggccttag ttcttatttt
tgagaaaata agaagtacag tggccattaa ttaaataaag ctacttcttg aaccattttt
aattaagtaa atgcctgact tttaagcgat aattagagat tagcgatatc aattaaatcg
atattgataa tatgttattt tagacgattt ggaagtaaaa taaataaaat ttgtttcagt
aaaaa
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003647 |gb|AE003647| arm:2L  15243654..15505601
estimated- cyto:35C5-35D3  gadfly- seqname:AE003647 
 seq_release:3 
Length = 261948
Score = 794 bits (413), Expect = 0.0 Genome Map
Identities = 413/413 (100%)
Strand = Plus / Plus
Query: 9 attcactgtacgggattcttaagtctactagtgtaaatatttatttaaaatatataaaac 68
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 239034 attcactgtacgggattcttaagtctactagtgtaaatatttatttaaaatatataaaac
239093
Query: 69 ttggcgggcagatgaatcttaaagtcgaaaaatgttttgccttgtattttacataaattt 128
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 239094 ttggcgggcagatgaatcttaaagtcgaaaaatgttttgccttgtattttacataaattt
239153
Query: 129 tgacacaacttatgcgacctctacagttaatttacagaagttggatactcgacgcaaata 188
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 239154 tgacacaacttatgcgacctctacagttaatttacagaagttggatactcgacgcaaata
239213
Query: 189 taaaacacatatgtagagaatccgctaagtctagggccttagttcttatttttgagaaaa 248
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 239214 taaaacacatatgtagagaatccgctaagtctagggccttagttcttatttttgagaaaa
239273
Query: 249 taagaagtacagtggccattaattaaataaagctacttcttgaaccatttttaattaagt 308
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 239274 taagaagtacagtggccattaattaaataaagctacttcttgaaccatttttaattaagt
239333
Query: 309 aaatgcctgacttttaagcgataattagagattagcgatatcaattaaatcgatattgat 368
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 239334 aaatgcctgacttttaagcgataattagagattagcgatatcaattaaatcgatattgat
239393
Query: 369 aatatgttattttagacgatttggaagtaaaataaataaaatttgtttcagta 421
|||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 239394 aatatgttattttagacgatttggaagtaaaataaataaaatttgtttcagta 239446
Score = 33.4 bits (17), Expect = 4.7 Genome Map
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 50 tatttaaaatatataaa 66
|||||||||||||||||
Sbjct: 138660 tatttaaaatatataaa 138644
Score = 33.4 bits (17), Expect = 4.7 Genome Map
Identities = 21/23 (91%)
Strand = Plus / Plus
Query: 186 atataaaacacatatgtagagaa 208
||||| | |||||||||||||||
Sbjct: 87488 atatataccacatatgtagagaa 87510
\#
anon- EST:Posey292  = CG32172
>anon- EST:Posey292 
ggcacgaggg gcacatcccg tctcatcccc actctctcga attgtgtccg ttggtagccg
aagttacgat tgcaaaactt tcgtcatctc tctctcactc tctgaagcaa aagccaaggc
cggagcaggt gcatatggtg ccaacccccc tggccccccc aaaagggggg tggtgctggt
gcaattgcaa aggcacagga gcacaggagc agctaaataa acaagaaagc aaaatcaaca
accgcaaaag tctaagacat gtatcacgaa ttgaaaatga taatgacaaa aa
Database: dmel_all_transcript_r320
>CG32172-RA type=mRNA; loc= 3L:complement (17348426..17350337); Genome Map
ID=noe-RA; name=noe-RA;
db_xref='CG32172,FlyBase:FBgn0026197'; len=1912
Length = 1912
Score = 417 bits (217), Expect = e-116
Identities = 250/283 (88%)
Strand = Plus / Plus
Query: 9 gggcacatcccgtctcatccccactctctcgaattgtgtccgttggtagccgaagttacg 68
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 143 gggcacatcccgtctcatccccactctctcgaattgtgtccgttggtagccgaagttacg 202
Query: 69 attgcaaaactttcgtcannnnnnnnnnnnnnnnngaagcaaaagccaaggccggagcag 128
|||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 203 attgcaaaactttcgtcatctctctctcactctctgaagcaaaagccaaggccggagcag 262
Query: 129 gtgcatatggtgccaannnnnnnnnnnnnnnnaaaaggggggtggtgctggtgcaattgc 188
|||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 263 gtgcatatggtgccaacccccctggcccccccaaaaggggggtggtgctggtgcaattgc 322
Query: 189 aaaggcacaggagcacaggagcagctaaataaacaagaaagcaaaatcaacaaccgcaaa 248
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 323 aaaggcacaggagcacaggagcagctaaataaacaagaaagcaaaatcaacaaccgcaaa 382
Query: 249 agtctaagacatgtatcacgaattgaaaatgataatgacaaaa 291
|||||||||||||||||||||||||||||||||||||||||||
Sbjct: 383 agtctaagacatgtatcacgaattgaaaatgataatgacaaaa 425
\#
anon- EST:Posey294  = CG2848
>anon- EST:Posey294 
ggcacgagtg aacctgatcc aggcctccgt ctttcagctg cactccaaca tgctggtgga
tgtggccnac gtgctccacg aactgaaggc aggtggtggg caacgagcgg atgcagccct
tcctggccca ggcgctggaa gcactgccca aaaagaacag cggtggctac ggtgacaccc
acgcagcgac agtctggact aatttagcag cacanttctg agagcggaca ccacgaaagc
catttcgcaa gccttgaaaa ccttcacgcg actctttcgc ttatcagggg agatgccatg
agtttggatt cggatgattc tggtgccttt tggaatgatg tatgtcatgt gg
Database: dmel_all_transcript_r320
>CG2848-SR-RA type=mRNA;
loc= 2L:join (2752484..2752715,2752786..2753877,
2754073..2754239,2754293..2755657,2755720..2756179);
ID=Trn-SR-RA; name=Trn-SR-RA;
db_xref='CG2848,FlyBase:FBgn0031456'; len=3316
Length = 3316
Genome Map
Score = 477 bits (248), Expect = e-134
Identities = 323/344 (93%), Gaps = 7/344 (2%)
Strand = Plus / Plus
Query: 9 tgaacctgatccaggcctccgtctttcagctgcactccaacatgctggtggatgtggccn 68
|||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 2646 tgaacctgatccaggcatccgtctttcagctgcactcctacatgctggtggatgtggccg 2705
Query: 69 acgtgctccacgaactgaaggcaggtggtgggcaacgagcggatgcagcccttcctggcc 128
| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 2706 aggtgctccacgaactgaag-caggtggtgggcaacgagcggatgcagcccttcctggcc 2764
Query: 129 caggcgctggaagcactgcccaaaaagaacagcggtggctacggtgacacccacgcagcg 188
||||||||||| ||||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 2765 caggcgctggaggcactgcccaaaaagaacagcggtggctacg-tgacagccacgcagca 2823
Query: 189 acagtctggactaatttagcagcacanttctgagagcggacaccacgaaagccatttcgc 248
|||| |||||| |||||||||||||| |||||||||||||||| ||||||||||||||||
Sbjct: 2824 acag-ctggacgaatttagcagcacagttctgagagcggacacaacgaaagccatttcgc 2882
Query: 249 aagccttgaaaaccttcacgcgactctttcgcttatcaggggagatgccatgagtttgga 308
||||||||||||||||||||||||||||||||| |||| |||||||| ||||||||||||
Sbjct: 2883 aagccttgaaaaccttcacgcgactctttcgctaatca-gggagatg-catgagtttgga 2940
Query: 309 ttcggatgattctggtgccttttggaatgatgtatgtcatgtgg 352
||||||||||||| || | |||| ||||||||||||| ||||||
Sbjct: 2941 ttcggatgattct-gtacatttt-gaatgatgtatgtaatgtgg 2982
\#
anon- EST:Posey35  = CG32172
>anon- EST:Posey35 
cgcccgttcg tgtaatcgct ggcgcgccac gccccccgcc cctcccactg tcacgcgctc
gccacgcccc ccagttgccg ccccattagc agcgggcaga tggacaacgt gtgggtggcc
cacaaggaca tctagtaaca cgacgcccaa cagcagccgc aaggtctgat acgccgcccg
ccacgcccat cgtgtttggg cggcagagga agcggtccgg aagcggaaac ggaaacgggc
gagcaaaatg gtggcgcggt atcgcgggca aggcgacggc gcgtccacaa aaaataacca
tagagacgtt taaggcaaat tctaaatgaa caaaagtata aaccaaaaac aattgtaacg
agaaaacaaa cgaattcaaa aatgagcaat atgagcaaca actaataatg gcaaaaagca
aaaacgacaa ctgcaaatta cgacacaaca ccttcgaaaa gacctcagta ataataaaaa
Database: dmel_all_transcript_r320
>CG32172-RA type=mRNA; loc= 3L:complement (17348426..17350337); Genome Map
ID=noe-RA; name=noe-RA;
db_xref='CG32172,FlyBase:FBgn0026197'; len=1912
Length = 1912
Score = 583 bits (303), Expect = e-166
Identities = 320/326 (98%), Gaps = 6/326 (1%)
Strand = Plus / Plus
Query: 3 cccgttcgtgtaatcgctggcgcgccacgccccccgcccctcccactgtcacgcgctcgc 62
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 634 cccgttcgtgtaatcgctggcgcgccacgccccccgcccctcccactgtcacgcgctcgc 693
Query: 63 cacgccccccagttgccgccccattagcagcgggcagatggacaacgtgtgggtggccca 122
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 694 cacgccccccagttgccgccccattagcagcgggcagatggacaacgtgtgggtggccca 753
Query: 123 caaggacatctagtaacacgacgcccaacagcagccgcaaggtctgatacgccgcccgcc 182
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 754 caaggacatctagtaacacgacgcccaacagcagccgcaaggtctgatacgccgcccgcc 813
Query: 183 acgcccatcgtgtttgggcggcagaggaagcggtccggaag------cggaaacggaaac 236
||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 814 acgcccatcgtgtttgggcggcagaggaagcggtccggaagcggaaacggaaacggaaac 873
Query: 237 gggcgagcaaaatggtggcgcggtatcgcgggcaaggcgacggcgcgtccacaaaaaata 296
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 874 gggcgagcaaaatggtggcgcggtatcgcgggcaaggcgacggcgcgtccacaaaaaata 933
Query: 297 accatagagacgtttaaggcaaattc 322
||||||||||||||||||||||||||
Sbjct: 934 accatagagacgtttaaggcaaattc 959
Score = 187 bits (97), Expect = 9e-47
Identities = 97/97 (100%)
Strand = Plus / Plus
Query: 384 gagcaatatgagcaacaactaataatggcaaaaagcaaaaacgacaactgcaaattacga 443
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1021 gagcaatatgagcaacaactaataatggcaaaaagcaaaaacgacaactgcaaattacga 1080
Query: 444 cacaacaccttcgaaaagacctcagtaataataaaaa 480
|||||||||||||||||||||||||||||||||||||
Sbjct: 1081 cacaacaccttcgaaaagacctcagtaataataaaaa 1117
\#
anon- EST:Posey37  = CG9282
>anon- EST:Posey37 
gagacgaatt cggcacgagg caagatgaaa attggcttgt gcgcattcag cgggtacaaa
atctaccccg gtcatggcaa gaccatggtc aagatcgatg gcaattcgtt caccttcctg
gacaaaaagt gcgagcgctc ctacctgatg aagcgcaatc cccgcaaggt tacttggacc
gtgctgtacc gccggaagca ccgcaaggga atcgaggagg agcctccang gaagcgcacc
cgccgcaccc agaatttcca gcgcgccatc gtcggtgcct cgctggccga nattctggcc
aagcgtaaca tgaacccgag gtgcgcaagg cgcagcgcga ccaggccatc aaggtggcca
aggaacaaaa gcgtgccgtc aaggccgcca aaaagctgct gcccccgctc ccgctaaaaa
tcggccccaa ncagaagccg ccaaggtcac
Database: dmel_all_transcript_r320
>CG9282-RA type=mRNA;
loc= 2L:complement (13382989..13383669,13383735..13383810,
13383926..13383985); ID=CG9282-RA; name=CG9282-RA;
db_xref='CG9282,FlyBase:FBgn0032518'; len=817
Length = 817
Genome Map
Score = 675 bits (351), Expect = 0.0
Identities = 415/436 (95%), Gaps = 5/436 (1%)
Strand = Plus / Plus
Query: 20 gcaagatgaaaattggcttgtgcgcattcagcgggtacaaaatctaccccggtcatggca 79
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 51 gcaagatgaaaattggcttgtgcgcattcagcgggtacaaaatctaccccggtcatggca 110
Query: 80 agaccatggtcaagatcgatggcaattcgttcaccttcctggacaaaaagtgcgagcgct 139
||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||
Sbjct: 111 agaccatggtcaagatcgatggcaagtcgttcaccttcctggacaagaagtgcgagcgct 170
Query: 140 cctacctgatgaagcgcaatccccgcaaggttacttggaccgtgctgtaccgccggaagc 199
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 171 cctacctgatgaagcgcaatccccgcaaggttacgtggaccgtgctgtaccgccggaagc 230
Query: 200 accgcaagggaatcgaggaggagcctccanggaagcgcacccgccgcacccagaatttcc 259
||||||||||||||||||||||| | | |||||||||||||||||||||||| ||||
Sbjct: 231 accgcaagggaatcgaggaggaggcctccaagaagcgcacccgccgcacccagaagttcc 290
Query: 260 agcgcgccatcgtcggtgcctcgctggccganattctggccaagcgtaacatgaa-cccg 318
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 291 agcgcgccatcgtcggtgcctcgctggccgagattctggccaagcgtaacatgaagcccg 350
Query: 319 aggtgcgcaaggcgcagcgcgaccaggccatcaaggtggccaaggaacaaaagcgtgccg 378
|||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||
Sbjct: 351 aggtgcgcaaggcgcagcgcgaccaggccatcaaggtggccaaggagcagaagcgtgccg 410
Query: 379 tcaaggccgccaa-aaagctgctgcccccgctcccgctaa-aaatcggc-cccaancaga 435
||||||||||||| || ||||||||||||||||||||||| || ||||| ||||| ||||
Sbjct: 411 tcaaggccgccaagaaggctgctgcccccgctcccgctaagaagtcggcgcccaagcaga 470
Query: 436 a-gccgccaaggtcac 450
| ||||||||||||||
Sbjct: 471 aggccgccaaggtcac 486
\#
anon- EST:Posey5  = CG1263
>anon- EST:Posey5 
ggcacgaggt accggtagga tccgtggtgg caagggcgac agcaaggaca agtaagctct
ggctgcagca ggattccggc gtagcgcagg ttccgcctga gatctgggta gtggtcgtgc
tctgctgtgc ggcgtcgtgg aagaaattgc tattctacat ggataatctg tatattctag
gcatacgctt gacacggcaa aataaaacnt atttgtaaaa
Database: dmel_all_transcript_r320
>CG1263-RB type=mRNA;
loc= 3L:join (2568108..2568142,2568205..2568519,
2568713..2569626); ID=RpL8-RB; name=RpL8-RB;
db_xref='CG1263,FlyBase:FBgn0024939'; len=1264
Length = 1264
Genome Map
Score = 387 bits (201), Expect = e-107
Identities = 208/212 (98%)
Strand = Plus / Plus
Query: 9 gtaccggtaggatccgtggtggcaagggcgacagcaaggacaagtaagctctggctgcag 68
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 937 gtaccggtaggatccgtggtggcaagggcgacagcaaggacaagtaagctctggctgcag 996
Query: 69 caggattccggcgtagcgcaggttccgcctgagatctgggtagtggtcgtgctctgctgt 128
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 997 caggattccggcgtggcgcaggttccgcctgagatctgggtagtggtcgtgctctgctgt 1056
Query: 129 gcggcgtcgtggaagaaattgctattctacatggataatctgtatattctaggcatacgc 188
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1057 gcggcgtcgtggaagaaattgctattctacatggataatctgtatgttctaggcatacgc 1116
Query: 189 ttgacacggcaaaataaaacntatttgtaaaa 220
||||||||||| |||||||| |||||||||||
Sbjct: 1117 ttgacacggcagaataaaacgtatttgtaaaa 1148
\#
anon- EST:Posey52  = CG31158?
>anon- EST:Posey52 
cacacgagca ttcatagata ctatatatag ttcatatata tatttatata tatgtgtata
tgcatagtat aacggctttc ctaagtttaa tcaaagctta tcagttagta ataaatgttc
acataaaaat caccgtctcc acgttcgtct tcttgtttcc cttctcgcca caagttggca
agttgtctta aatgaattgt tatcgaaagg gtattgcttt agaaactaag tgatgccctc
ttaagccagt taaaatgttt gactaaataa atatacaata tgcatacatt taggcgcttg
gtttgcagca ggcaagttgc tttcactttt agttagtttg tattttcgaa tttattgccg
tttcagtaga attgttaaaa attattataa acaatgttat atagtctgca tttacataat
tacacaatac cataatcata atatattcaa aaatatatga tgcatttaat tttatttttt
cctccatctc tctttacccc gtaatggata tttaatttca tattctagct acatggacat
gtcgcgtaat caaccgatag ttgtttaaat aaatatatta atccgtacat aatattggag
taactgttcc tacacagtta aatgtgataa tgtatcgcaa aagaccaaaa acaagttgta
cacggtatgg tagtaattgc ttaagcttaa tgctaatgcg cttgtcctct tctcaattct
catttcgtta ttgttactgc cgatgttctc catcttgtgg ttgtgtagag atattgttca
ttaattaata atttatttty atcatttata atgatagcat aggtratgat gtaagtattg
tttatcaact ctkgtaataa taagtctatg tgtataagca gttttcattc tcgttcctaa
acagccgtcc agcagaatct ttggcggagc aaatatgaac gataattcaa attcgaatcg
atctgactgt gtagctttaa atcaggtgaa accgatctcg aataccctca ttnctggata
agtagcatgg taaatataaa atcaactgca cgaattcgag ataatcctct ggttgccgag
atctcgtncc gaattcgtct c
Database: dmel_all_transcript_r320
>CG31158-RB type=mRNA;
loc= 3R:join (18415336..18415350,18415597..18415663,
18415740..18415793,18416052..18416854,18416923..18418044,
18419223..18420301,18420368..18420754,18420808..18420971,
18421030..18421127,18421194..18421469,18421533..18421670,
18421731..18421948,18423575..18423686,
18423770..18424849); ID=CG31158-RB; name=CG31158-RB;
db_xref='CG31158,FlyBase:FBgn0051158'; len=5613
Length = 5613
Genome Map
Score = 1419 bits (737), Expect = 0.0
Identities = 744/748 (99%), Gaps = 1/748 (0%)
Strand = Plus / Minus
Query: 335 agtttgtattttcgaatttattgccgtttcagtagaattgttaaaaattattataaacaa 394
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5613 agtttgtattttcgaatttattgccgtttcagtagaattgttaaaaattattataaacaa 5554
Query: 395 tgttatatagtctgcatttacataattacacaataccataatcataatatattcaaaaat 454
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5553 tgttatatagtctgcatttacataattacacaataccataatcataatatattcaaaaat 5494
Query: 455 atatgatgcatttaattttattttttcctccatctctctttaccccgtaatggatattta 514
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5493 atatgatgcatttaattttattttttcctccatctctctttaccccgtaatggatattta 5434
Query: 515 atttcatattctagctacatggacatgtcgcgtaatcaaccgatagttgtttaaataaat 574
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5433 atttcatattctagctacatggacatgtcgcgtaatcaaccgatagttgtttaaataaat 5374
Query: 575 atattaatccgtacataatattggagtaactgttcctacacagttaaatgtgataatgta 634
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5373 atattaatccgtacataatattggagtaactgttcctacacagttaaatgtgataatgta 5314
Query: 635 tcgcaaaagaccaaaaacaagttgtacacggtatggtagtaattgcttaagcttaatgct 694
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5313 tcgcaaaagaccaaaaacaagttgtacacggtatggtagtaattgcttaagcttaatgct 5254
Query: 695 aatgcgcttgtcctcttctcaattctcatttcgttattgttactgccgatgttctccatc 754
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5253 aatgcgcttgtcctcttctcaattctcatttcgttattgttactgccgatgttctccatc 5194
Query: 755 ttgtggttgtgtagagatattgttcattaattaataatttattttyatcatttataatga 814
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 5193 ttgtggttgtgtagagatattgttcattaattaataatttatttttatcatttataatga 5134
Query: 815 tagcataggtratgatgtaagtattgtttatcaactctkgtaataataagtctatgtgta 874
|||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 5133 tagcataggtaatgatgtaagtattgtttatcaactcttgtaataataagtctatgtgta 5074
Query: 875 taagcagttttcattctcgttcctaaacagccgtccagcagaatctttggcggagcaaat 934
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5073 taagcagttttcattctcgttcctaaacagccgtccagcagaatctttggcggagcaaat 5014
Query: 935 atgaacgataattcaaattcgaatcgatctgactgtgtagctttaaatcaggtgaaaccg 994
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5013 atgaacgataattcaaattcgaatcgatctgactgtgtagctttaaatcaggtgaaaccg 4954
Query: 995 atctcgaataccctcattnctggataagtagcatggtaaatataaaatcaactgcacgaa 1054
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 4953 atctcgaataccctcatt-ctggataagtagcatggtaaatataaaatcaactgcacgaa 4895
Query: 1055 ttcgagataatcctctggttgccgagat 1082
||||||||||||||||||||||||||||
Sbjct: 4894 ttcgagataatcctctggttgccgagat 4867
\#
anon- EST:Posey55  = CG11739
>anon- EST:Posey55 
ggcacgagtc gaaatactcc tgatattagc ctgaccgcat atgcttaccg ttcacagcaa
gcgacacgtc agtgaatcaa atttacagtg tatattatag tgattgtgta aaagtgaaaa
tgtatgaaac aaaaatatat ctgttaactg ttatctgaac tcagtttc
Database: dmel_all_transcript_r320
>CG11739-RD type=mRNA;
loc= 3R:join (204643..204730,205171..205339,205396..205545,
205649..205766,205830..205991,206225..206352,
206424..206931); ID=CG11739-RD; name=CG11739-RD;
db_xref='CG11739,FlyBase:FBgn0037239'; len=1323
Length = 1323
Genome Map
Score = 308 bits (160), Expect = 1e-83
Identities = 160/160 (100%)
Strand = Plus / Plus
Query: 9 tcgaaatactcctgatattagcctgaccgcatatgcttaccgttcacagcaagcgacacg 68
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1164 tcgaaatactcctgatattagcctgaccgcatatgcttaccgttcacagcaagcgacacg 1223
Query: 69 tcagtgaatcaaatttacagtgtatattatagtgattgtgtaaaagtgaaaatgtatgaa 128
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1224 tcagtgaatcaaatttacagtgtatattatagtgattgtgtaaaagtgaaaatgtatgaa 1283
Query: 129 acaaaaatatatctgttaactgttatctgaactcagtttc 168
||||||||||||||||||||||||||||||||||||||||
Sbjct: 1284 acaaaaatatatctgttaactgttatctgaactcagtttc 1323
\#
anon- EST:Posey59  = CG8472
>anon- EST:Posey59 
acgagatcgt ttcgagcaac aagaacaaca agtctatcac tacacttaaa caaaatgagg
agcgtgaaga agacgagcaa gcagagggag aagcaagaag cagcagcagc ntccaccatt
attgccgaaa gatggcgccc atggcgcact aaggtcagcg cgccacctgg cgacggcggc
tcgcaccggc tgcattttgt ttgacagttt tccactaagg aagtaaagaa aaaaaattat
gaaaaccccc cactctgtaa gctagcaaat tgtgtttaaa gtataatnaa aaaattgtcg
atttcgttgc gagaaagaat aaaantaaaa gct
Database: dmel_all_transcript_r320
>CG8472-RB type=mRNA;
loc= 2R:join (7329273..7329388,7329456..7329630,
7333906..7334148,7338479..7339338); ID=Cam-RB;
name=Cam-RB; db_xref='CG8472,FlyBase:FBgn0000253';
len=1394
Length = 1394
Genome Map
Score = 533 bits (277), Expect = e-151
Identities = 312/330 (94%), Gaps = 3/330 (0%)
Strand = Plus / Plus
Query: 6 atcgtttcgagcaacaagaacaacaagtctatcactacacttaaacaaaatgaggagcgt 65
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1051 atcgtttcgagcaacaagaacaacaagtctatcactacacttaaacaaaatgaggagcga 1110
Query: 66 gaagaagacgagcaagcagagggagaagcaagaagcagcagcagcntccaccattattgc 125
||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||
Sbjct: 1111 gaagaagacgagcaagcagagggagaagcaagaagcagcagcagcatccaccagtattgc 1170
Query: 126 cgaaagatggcgcccatggcgcactaaggtcagcgcgccacctggcgacggcggctcgca 185
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1171 cgaaagatggcgcccatggcgcactaaggtcagcgcgccacctggcgacggcggctcgca 1230
Query: 186 ccggctgcattttgtttgacagttttccactaaggaagt--aaagnnnnnnnnttatgaa 243
||||||||||||||||||||||||||||||||| ||||| ||| | |||||
Sbjct: 1231 ccggctgcattttgtttgacagttttccactaa-gaagtaaaaaaaaagaaaataatgaa 1289
Query: 244 aaccccccactctgtaagctagcaaattgtgtttaaagtataatnaaaaaattgtcgatt 303
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 1290 aaccccccactctgtaagctagcaaattgtgtttaaagtataatgaaaaaattgtcgatt 1349
Query: 304 tcgttgcgagaaagaataaaantaaaagct 333
||||||||||||||||||||| ||||||||
Sbjct: 1350 tcgttgcgagaaagaataaaaataaaagct 1379
\#
anon- EST:Posey6  = CG6253
>anon- EST:Posey6 
ggcacgagtt tttttttncc taaaaataac actttctttt atttcctcca tggtggtgga
tnttcatcaa gcagttactt tcgttaaagg tagtattttt tacttcttgg ccgcggcctt
cttgccaccc ttggccttct cggcacncaa accctcgcaa caatccttct tgaggacccg
gggattnccn tcagccttgg tgcnctnctt cattttttta aaggcaatgg tcagcacctt
nttgcnctaa cccttggcat aacccacctt gaagcggtca aattctttca acaaggagcn
cttgcaaatt ttctntgcct tgacggacca ggggctnacc ttccnctggg ccttcaggtc
gctctctntc caggccttgc ccacaatc
Database: dmel_all_transcript_r320
>CG6253-RA type=mRNA;
loc= 3L:join (8559712..8559747,8560024..8560125,
8560358..8560552,8560813..8561109); ID=RpL14-RA;
name=RpL14-RA; db_xref='CG6253,FlyBase:FBgn0017579';
len=630
Length = 630
Genome Map
Score = 512 bits (266), Expect = e-144
Identities = 326/366 (89%)
Strand = Plus / Minus
Query: 19 cctaaaaataacactttcttttatttcctccatggtggtggatnttcatcaagcagttac 78
|||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||
Sbjct: 615 cctaaaaataacactttcttttattttctccatggtggtggatgttcatcaagcagttac 556
Query: 79 tttcgttaaaggtagtattttttacttcttggccgcggccttcttgccacccttggcctt 138
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 555 tttcgttaaaggtagtattttttacttcttggccgcggccttcttgccacccttggcctt 496
Query: 139 ctcggcacncaaaccctcgcaacaatccttcttgaggacccggggattnccntcagcctt 198
|||||||| || || ||||| || ||||||||||||||| |||||| | || ||||||||
Sbjct: 495 ctcggcacgcagacgctcgcgacgatccttcttgaggacgcggggagtgccgtcagcctt 436
Query: 199 ggtgcnctncttcannnnnnnaaaggcaatggtcagcaccttnttgcnctaacccttggc 258
||||| || ||||| ||||| |||||||||| ||| |||| || || ||||||
Sbjct: 435 ggtgcgcttcttcagtgtgttgaaggcgatggtcagcagcttgttgcgctgacgcttggc 376
Query: 259 ataacccaccttgaagcggtcaaattctttcaacaaggagcncttgcaaattttctntgc 318
||||| || ||||||||||||||| || |||||| |||||| |||||| || |||| |||
Sbjct: 375 ataacgcagcttgaagcggtcaaagtcgttcaacgaggagcgcttgcagatgttctgtgc 316
Query: 319 cttgacggaccaggggctnaccttccnctgggccttcaggtcgctctctntccaggcctt 378
|||||||||||||||||| ||||||| |||||||||||||||||||||| ||||||||||
Sbjct: 315 cttgacggaccaggggctgaccttccactgggccttcaggtcgctctctgtccaggcctt 256
Query: 379 gcccac 384
|| |||
Sbjct: 255 gcgcac 250
\#
anon- EST:Posey64  = CG11593
>anon- EST:Posey64 
ggcacgagat tttatagagg aacatacata tgcaaccaga aaccaccaaa cttccgaaca
tgttaccttt cctttgtagt ggcaaaaaga aaaaaaaaaa acacaaagtt ggaaacggag
caacacacta aactgaatct aaacataagt aattgaaaat ctttagctga attttgcatc
ttatatcgca tattgtatat tccaagcgtt ccaaacacga cactttcgct gacacatgat
ggaccccatg ccagtcgaca gtaggtgccc catttatctc atccaccatc agagttagcc
gattagcctg taagtgaaat agcgaccatt ctttgtggaa tctacacacg gacacacgta
gaatctctct agcggataat gtgacgtaca attaggcaat gtaaccgatt gatattaaga
gcgacatttt gtggtttcct tttaccgctt taaacaaaca ataataataa agtgcaagat
gatttttatt tattacgcaa taaaaa
Database: dmel_all_transcript_r320
>CG11593-RA type=mRNA;
loc= 3L:complement (4018216..4019208,4019271..4019381,
4019443..4020660,4020725..4021111); ID=CG11593-RA;
name=CG11593-RA; db_xref='CG11593,FlyBase:FBgn0035488';
len=2709
Length = 2709
Genome Map
Score = 819 bits (426), Expect = 0.0
Identities = 451/470 (95%), Gaps = 1/470 (0%)
Strand = Plus / Plus
Query: 9 attttatagaggaacatacatatgcaaccagaaaccaccaaacttccgaacatgttacct 68
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2240 attttatagaggaacatacatatgcaaccagaaaccaccaaacttccgaacatgttacct 2299
Query: 69 ttcctttgtagtggcnnnnnnnnnnnnnnnnnncacaaagttggaaacggagcaacacac 128
||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 2300 ttcctttgtagtggcaaaaagaaaaaaaaaaaacacaaagttggaaacggagcaacacac 2359
Query: 129 taaactgaatctaaacataagtaattgaaaatctttagctgaattttgcatcttatatcg 188
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2360 taaactgaatctaaacataagtaattgaaaatctttagctgaattttgcatcttatatcg 2419
Query: 189 catattgtatattccaagcgttccaaacacgacactttcgctgacacatgatggacccca 248
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2420 catattgtatattccaagcgttccaaacacgacactttcgctgacacatgatggacccca 2479
Query: 249 tgccagtcgacagtaggtgccccatttatctcatccaccatcagagttagccgattagcc 308
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2480 tgccagtcgacagtaggtgccccatttatctcatccaccatcagagttagccgattagcc 2539
Query: 309 tgtaagtgaaatagcgaccattctttgtggaatctacacacggacacacgtagaatctct 368
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2540 tgtaagtgaaatagcgaccattctttgtggaatctacacacggacacacgtagaatctct 2599
Query: 369 ctagcggataatgtgacgtacaattaggcaatgtaaccgattgatattaagagcgacatt 428
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2600 ctagcggataatgtgacgtacaattaggcaatgtaaccgattgatattaagagcgacatt 2659
Query: 429 ttg-tggtttccttttaccgctttaaacaaacaataataataaagtgcaa 477
||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2660 ttgttggtttccttttaccgctttaaacaaacaataataataaagtgcaa 2709
\#
anon- EST:Posey65  = CG16982
>anon- EST:Posey65 
ggcacgagag cgctttgagg tgaagaagtg gaacgccgtg gctctgtggg cctgggacat
cgtggtggac aactgcgcca tctgccgcaa ccacatcatg gacttgtgca tcgagtgtca
ggcgaaccag gcgtccgcca ctagcgagga gtgcaccgtg gcctggggcg tctgcaacca
cgccttccat ttccactgca tctctcgctg gctaaagacg cgccaggtat gcccactgga
caaccgcgag tgggatttcc agaagtacgg ccactaaaat ctacaaaacc cccaagaccc
accagatgga gggagcagca cttcccgcaa gctagatgat ggaggcctgc ttcatctgga
catttgaata cctttttaga tcttaagcta gtggggcgat tcgagtgaac tggtagcctt
taggagcaca gttaccgatt tccgagactt ccccgggaag cgcacctttt tgtacgcgtt
aaataaaagc tgtagaagat ggagaaagac tnaaaaa
Database: dmel_all_transcript_r320
>CG16982-RA type=mRNA;
loc= X:join (404724..404962,405047..405074,
405140..406040); ID=Roc1a-RA; name=Roc1a-RA;
db_xref='CG16982,FlyBase:FBgn0025638'; len=1168
Length = 1168
Genome Map
Score = 929 bits (483), Expect = 0.0
Identities = 497/499 (99%), Gaps = 2/499 (0%)
Strand = Plus / Plus
Query: 9 agcgctttgaggtgaagaagtggaacgccgtggctctgtgggcctgggacatcgtggtgg 68
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 220 agcgctttgaggtgaagaagtggaacgccgtggctctgtgggcctgggacatcgtggtgg 279
Query: 69 acaactgcgccatctgccgcaaccacatcatggacttgtgcatcgagtgtcaggcgaacc 128
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 280 acaactgcgccatctgccgcaaccacatcatggacttgtgcatcgagtgtcaggcgaacc 339
Query: 129 aggcgtccgccactagcgaggagtgcaccgtggcctggggcgtctgcaaccacgccttcc 188
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 340 aggcgtccgccactagcgaggagtgcaccgtggcctggggcgtctgcaaccacgccttcc 399
Query: 189 atttccactgcatctctcgctggctaaagacgcgccaggtatgcccactggacaaccgcg 248
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 400 atttccactgcatctctcgctggctaaagacgcgccaggtatgcccactggacaaccgcg 459
Query: 249 agtgggatttccagaagtacggccactaaaatctacaaaacccccaagacccaccagatg 308
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 460 agtgggatttccagaagtacggccactaaaatctacaaaacccccaagacccaccagatg 519
Query: 309 gagggagcagcacttcccgcaagctagatgatggaggcctgcttcatctggacatttgaa 368
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 520 gagggagcagcacttcccgcaagctagatgatggaggcctgcttcatctggacatttgaa 579
Query: 369 tacctttttagatcttaagctagtggggcgattcgagtgaactggtagcctttaggagca 428
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 580 tacctttttagatcttaagctagtggggcgattcgagtgaactggtagcctttaggagca 639
Query: 429 cagttaccgatttccgagacttccccgggaagcgcacctttttgt-acgcgttaaataaa 487
|||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||
Sbjct: 640 cagttaccgatttccgagac-tccccgggaagcgcacctttttgtaacgcgttaaataaa 698
Query: 488 agctgtagaagatggagaa 506
|||||||||||||||||||
Sbjct: 699 agctgtagaagatggagaa 717
\#
anon- EST:Posey67  = CG8309
>anon- EST:Posey67 
gcacgagaag cgccgaagac gtgtgtgcgt gttattttca gctgaatttg tttaaaaaag
tggaataaca tttaacaaaa ccatgacttc gcatccggtt ttcatagacc tgtccctgga
cgagcaggtg caagagctgc gcaagtattt caagaagctg ggagccgaaa tctcatcgga
gaagtccaat aaaggtgtgg aggatgattt gcacaagatc atcggcgtct gcgacgtttg
ctttaaggat ggtgagccct cgcagattga tggcattctg aacagcattg tgtccatcat
gatcacgata cccctggatc gcggtgagaa cattgtcctg gcctactgcg agaagatgac
caaggctccc aatcttccat tgggcaaagg tgtgccttnc agtcgttgtg gcgtctgttc
aacnaacctg gacaccgcct ctcctttacg ctaccatgtg tactaccacc tggtccaggt
ggccaagcag tgcgaacagg tgctggaggt cttctcaggt gtggatcagc tcaaatccca
gtttgccaac tgcccacctt cgtcggaaca gatgcagaag ctgtaccgcc tgctgcacga
cgtgaccaag gacaccaacc tggagctgtc ttccaaggtt atgattgagc tgctgggcac
ctacacggcg gacaatgctt gtgttgcccg tgaggatgcc atgaagtgca ttgtgactgc
cttggctgac cccaatacat tcctgctgga tcctctgctg tcgctgaagc ctgtgcgctt
tttggaaggc gacctcatcc acgacctgct gtccatcttc gtgtccgaga agctgccagc
gtacgtgcag ttctacgagg atcacaggga gtttgtcaac tcgcaaggat tgaaccatga
gcagaacatg aagnaagatg cgtctgctga ccttcatgca gctggccgag agcagcccgg
agatgacatt cgaaancgct taccaaggag ctgcagatca acgaagacga ggtggagccc
ttcgtcattg aggtgctgaa aacaaagctg gtacgcgcac gactagatca ggccaatcaa
aaggtacaca tctcatcgac aatgcaccga acctttggag caccacaatg ggagcagctt
cgcgatttgc tgcaggcatg gaaggagaac ctcagcacag tgcgcgaggg tctaacgagc
gtctcctcgg cgcaactgga tctggctcga tcccagaagc tgatacacta ggcgcaccac
ttccaaaaaa attgcactga tgatgaacaa atgctggcct cggggcactg gagtgacgac
ctaaattatt ttcaagaatg cgagagggct ggataacttg aataaattta taagtaaaat
ctgtaaaaag cccggg
Database: dmel_all_transcript_r320
>CG8309-RA type=mRNA;
loc= 2R:complement (9227837..9228907,9228962..9229141,
9229258..9229640); ID=CG8309-RA; name=CG8309-RA;
db_xref='CG8309,FlyBase:FBgn0033902'; len=1634
Length = 1634
Genome Map
Score = 2498 bits (1299), Expect = 0.0
Identities = 1357/1374 (98%), Gaps = 6/1374 (0%)
Strand = Plus / Plus
Query: 8 aagcgccgaagacgtgtgtgcgtgttattttcagctgaatttgtttaaaaaagtggaata 67
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 264 aagcgccgaagacgtgtgtgcgtgttattttcagctgaatttgtttaaaaaagtggaata 323
Query: 68 acatttaacaaaaccatgacttcgcatccggttttcatagacctgtccctggacgagcag 127
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 324 acatttaacaaaaccatgacttcgcatccggttttcatagacctgtccctggacgagcag 383
Query: 128 gtgcaagagctgcgcaagtatttcaagaagctgggagccgaaatctcatcggagaagtcc 187
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 384 gtgcaagagctgcgcaagtatttcaagaagctgggagccgaaatctcatcggagaagtcc 443
Query: 188 aataaaggtgtggaggatgatttgcacaagatcatcggcgtctgcgacgtttgctttaag 247
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 444 aataaaggtgtggaggatgatttgcacaagatcatcggcgtctgcgacgtttgctttaag 503
Query: 248 gatggtgagccctcgcagattgatggcattctgaacagcattgtgtccatcatgatcacg 307
|||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||
Sbjct: 504 gatggtgagccctcgcagattgatggaattctaaacagcattgtgtccatcatgatcacg 563
Query: 308 atacccctggatcgcggtgagaacattgtcctggcctactgcgagaagatgaccaaggct 367
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 564 atacccctggatcgcggtgagaacattgtcctggcctactgcgagaagatgaccaaggct 623
Query: 368 cccaatcttccattgggcaaaggtgtgccttncagtcgttgtggcgtctgttcaacnaac 427
|||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |||
Sbjct: 624 cccaatcttccattgggcaa-ggtgtgcctt-cagtcgttgtggcgtctgttcaac-aac 680
Query: 428 ctggacaccgcctctcctttacgctaccatgtgtactaccacctggtccaggtggccaag 487
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 681 ctggacaccgcctctcccttacgctaccatgtgtactaccacctggtccaggtggccaag 740
Query: 488 cagtgcgaacaggtgctggaggtcttctcaggtgtggatcagctcaaatcccagtttgcc 547
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 741 cagtgcgaacaggtgctggaggtcttctcaggtgtggatcagctcaaatcccagtttgcc 800
Query: 548 aactgcccaccttcgtcggaacagatgcagaagctgtaccgcctgctgcacgacgtgacc 607
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 801 aactgcccaccttcgtcggaacagatgcagaagctgtaccgcctgctgcacgacgtgacc 860
Query: 608 aaggacaccaacctggagctgtcttccaaggttatgattgagctgctgggcacctacacg 667
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 861 aaggacaccaacctggagctgtcttccaaggttatgattgagctgctgggcacctacacg 920
Query: 668 gcggacaatgcttgtgttgcccgtgaggatgccatgaagtgcattgtgactgccttggct 727
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 921 gcggacaatgcttgtgttgcccgtgaggatgccatgaagtgcattgtgactgccttggcc 980
Query: 728 gaccccaatacattcctgctggatcctctgctgtcgctgaagcctgtgcgctttttggaa 787
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 981 gaccccaatacattcctgctggatcctctgctgtcgctgaagcctgtgcgctttttggaa 1040
Query: 788 ggcgacctcatccacgacctgctgtccatcttcgtgtccgagaagctgccagcgtacgtg 847
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1041 ggcgacctcatccacgacctgctgtccatcttcgtgtccgagaagctgccagcgtacgtg 1100
Query: 848 cagttctacgaggatcacagggagtttgtcaactcgcaaggattgaaccatgagcagaac 907
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1101 cagttctacgaggatcacagggagtttgtcaactcgcaaggattgaaccatgagcagaac 1160
Query: 908 atgaagnaagatgcgtctgctgaccttcatgcagctggccgagagcagcccggagatgac 967
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1161 atgaag-aagatgcgtctgctgaccttcatgcagctggccgagagcagcccggagatgac 1219
Query: 968 attcgaaancgcttaccaaggagctgcagatcaacgaagacgaggtggagcccttcgtca 1027
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1220 attcgaaa-cgcttaccaaggagctgcagatcaacgaagacgaggtggagcccttcgtca 1278
Query: 1028 ttgaggtgctgaaaacaaagctggtacgcgcacgactagatcaggccaatcaaaaggtac 1087
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1279 tcgaggtgctgaaaacaaagctggtacgcgcacgactagatcaggccaatcaaaaggtac 1338
Query: 1088 acatctcatcgacaatgcaccgaacctttggagcaccacaatgggagcagcttcgcgatt 1147
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1339 acatctcatcgacaatgcaccgaacctttggagcaccacaatgggagcagcttcgcgatt 1398
Query: 1148 tgctgcaggcatggaaggagaacctcagcacagtgcgcgagggtctaacgagcgtctcct 1207
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1399 tgctgcaggcatggaaggagaacctcagcacagtgcgcgagggtctaacgagcgtctcct 1458
Query: 1208 cggcgcaactggatctggctcgatcccagaagctgatacactaggcgcaccacttccnnn 1267
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1459 cggcgcaactggatctggctcgatcccagaagctgatacactaggcgcaccacttcc-aa 1517
Query: 1268 nnnnttgcactgatgatgaacaaatgctggcctcggggcactggagtgacgacctaaatt 1327
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1518 aaaattgcactgatgatgaacaaatgctggcctcggggcactggagtgacgacctaaatt 1577
Query: 1328 attttcaagaatgcgagagggctggataacttgaataaatttataagtaaaatc 1381
||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1578 attttcaagaatgcgagagggctggataacttgaataaatttataagtaaaatc 1631
\#
anon- EST:Posey69  = CG31543
>anon- EST:Posey69 
acccaccaaa cccaaaaaaa gagacgaatt cggcacgagg ccgacagcgc agctaaaggc
aaccaaaaag tgtaaattat tttcaaccaa acacacatgt ataaagctag ttaaaaacta
tttatagctt cggaggggcg gcagcgcaag cccgcattgc gaaagttaat caaagctcct
ttagtcgtta agccttctag tttagtctct aagtcgtacc cttagtcatt ttcgcattaa
ccattagctt actgccatgt cagcgtccga gttggttgtt tattaatttt agtttgttgc
atctttgtca ggaccttttg cctagctcat tcttagtttt tggctgccaa agtattatac
ctaaagagaa gttaactaga ttcaataaca taagcaactg tcgcgacgct cattgcatct
tatctcaaaa ttatttaaca agccagtaaa tcgtggacaa acgcggtcac tggctaacac
tcaatctgtc gactctcatg catcttgtta gacatctttt tcatatcgtt tacatctaat
aacaaacgga aataaatgtt ngtccanata cgttctcttg ttatctgtaa atcatgaagt
atgtatattt atgacatatc tacatattgt atgtatattt tttatattaa acaaaagcct
gagctgatga accacgtgtg gccnacattt gtctacgtgg ttgtagagag atggatttta
taagtg
Database: dmel_all_transcript_r320
>CG31543-RB type=mRNA;
loc= 3R:join (1090663..1090921,1092472..1092751,
1092840..1092920,1092982..1093121,1093181..1094194);
ID=Hph-RB; name=Hph-RB;
db_xref='CG31543,FlyBase:FBgn0037308'; len=1774
Length = 1774
Genome Map
Score = 1204 bits (626), Expect = 0.0
Identities = 628/630 (99%)
Strand = Plus / Plus
Query: 40 gccgacagcgcagctaaaggcaaccaaaaagtgtaaattattttcaaccaaacacacatg 99
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1145 gccgacagcgcagctaaaggcaaccaaaaagtgtaaattattttcaaccaaacacacatg 1204
Query: 100 tataaagctagttaaaaactatttatagcttcggaggggcggcagcgcaagcccgcattg 159
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1205 tataaagctagttaaaaactatttatagcttcggaggggcggcagcgcaagcccgcattg 1264
Query: 160 cgaaagttaatcaaagctcctttagtcgttaagccttctagtttagtctctaagtcgtac 219
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1265 cgaaagttaatcaaagctcctttagtcgttaagccttctagtttagtctctaagtcgtac 1324
Query: 220 ccttagtcattttcgcattaaccattagcttactgccatgtcagcgtccgagttggttgt 279
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1325 ccttagtcattttcgcattaaccattagcttactgccatgtcagcgtccgagttggttgt 1384
Query: 280 ttattaattttagtttgttgcatctttgtcaggaccttttgcctagctcattcttagttt 339
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1385 ttattaattttagtttgttgcatctttgtcaggaccttttgcctagctcattcttagttt 1444
Query: 340 ttggctgccaaagtattatacctaaagagaagttaactagattcaataacataagcaact 399
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1445 ttggctgccaaagtattatacctaaagagaagttaactagattcaataacataagcaact 1504
Query: 400 gtcgcgacgctcattgcatcttatctcaaaattatttaacaagccagtaaatcgtggaca 459
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1505 gtcgcgacgctcattgcatcttatctcaaaattatttaacaagccagtaaatcgtggaca 1564
Query: 460 aacgcggtcactggctaacactcaatctgtcgactctcatgcatcttgttagacatcttt 519
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1565 aacgcggtcactggctaacactcaatctgtcgactctcatgcatcttgttagacatcttt 1624
Query: 520 ttcatatcgtttacatctaataacaaacggaaataaatgttngtccanatacgttctctt 579
||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 1625 ttcatatcgtttacatctaataacaaacggaaataaatgtttgtccaaatacgttctctt 1684
Query: 580 gttatctgtaaatcatgaagtatgtatatttatgacatatctacatattgtatgtatatt 639
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1685 gttatctgtaaatcatgaagtatgtatatttatgacatatctacatattgtatgtatatt 1744
Query: 640 ttttatattaaacaaaagcctgagctgatg 669
||||||||||||||||||||||||||||||
Sbjct: 1745 ttttatattaaacaaaagcctgagctgatg 1774
\#
anon- EST:Posey7  = end of CHES-1-like ?
>anon- EST:Posey7 
ggcacgaggt tacacgtaca tagttgaaat atgctaaaca tttgttaaca cgaatccaat
cgtaagctag ccgattttag ttgaatgaac ctcctgcaat tttcctaccc aaggtgtaca
tatatacaaa atggattaag ctgttgaaat gatgctgcac atctttacat aggcatattg
tggaaaccaa gaaatactta ttaattaaat aattaaatag gcgaaaggaa aaaaacttga
caaagaacgc cctaagtgtt tacacttcat gtaccttttt agcaaaaagc aaaaaacgca
aaagcaaaga tcgcattaaa attgtataca tacattatat ttaaactacc aattacgaaa
ctaaactaaa tgttgatgtc aaagagaaac caatttgcta gttgttacca atcagaaaag
aacactttaa acaaaaa
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003441 |gb|AE003441| arm:X  7253939..7539888
estimated- cyto:7B3-7B8  gadfly- seqname:AE003441 
 seq_release:3 
Length = 285950
Score = 498 bits (259), Expect = e-140 Genome Map
Identities = 266/273 (97%)
Strand = Plus / Minus
Query: 8 ggttacacgtacatagttgaaatatgctaaacatttgttaacacgaatccaatcgtaagc 67
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 171016 ggttacacgtacatagttgaaatatgctaaacatttgttaacacgaatccaatcgtaagc
170957
Query: 68 tagccgattttagttgaatgaacctcctgcaattttcctacccaaggtgtacatatatac 127
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 170956 tagccgattttagttgaatgaacctcctgcaattttcctacccaaggtgtacatatatac
170897
Query: 128 aaaatggattaagctgttgaaatgatgctgcacatctttacataggcatattgtggaaac 187
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 170896 aaaatggattaagctgttgaaatgatgctgcacatctttacataggcatattgtggaaac
170837
Query: 188 caagaaatacttattaattaaataattaaataggcgaaaggnnnnnnncttgacaaagaa 247
||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 170836 caagaaatacttattaattaaataattaaataggcgaaaggaaaaaaacttgacaaagaa
170777
Query: 248 cgccctaagtgtttacacttcatgtaccttttt 280
|||||||||||||||||||||||||||||||||
Sbjct: 170776 cgccctaagtgtttacacttcatgtaccttttt 170744
Score = 237 bits (123), Expect = 2e-61 Genome Map
Identities = 127/129 (98%)
Strand = Plus / Minus
Query: 309 gatcgcattaaaattgtatacatacattatatttaaactaccaattacgaaactaaacta 368
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 170715 gatcgcattaaaattgtatacatacattatatttaaactaccaattacgaaactaaacta
170656
Query: 369 aatgttgatgtcaaagagaaaccaatttgctagttgttaccaatcagaaaagaacacttt 428
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 170655 aatgttgatgtcaaagagaaaccaatttgctagttgttaccaatcagaaaagaacacata
170596
Query: 429 aaacaaaaa 437
|||||||||
Sbjct: 170595 aaacaaaaa 170587
Score = 33.4 bits (17), Expect = 4.8 Genome Map
Identities = 19/20 (95%)
Strand = Plus / Plus
Query: 159 acatctttacataggcatat 178
||||||||||||| ||||||
Sbjct: 6725 acatctttacatacgcatat 6744
\#
anon- EST:Posey79  = CG5889
>anon- EST:Posey79 
ggcacgagat cgattacccc ctacaaaccg accgcctaga acaattggct agacagcaga
gctaactggt gagaacaacc caaacaagca aacaaccaaa caactaaaca gccaaccatc
caaccgattc cacatgtaaa acaacttaac tcgctgccgt taaccaccac caactatcta
agttagaaca ttatgctttc tatcgattag ttcacttata tctgtagata tattcgagcg
acgattatgt ttgttgttta gccatatctg atatttatta acgcaattaa gcagctttgt
tataatttat tgttaaaagg tcgagcctaa tgtatcagta actagaaaac ctaacccctt
atgatcgatc ggaccgattc agccattgta ccactgacta gatgatgatg atgtgcgata
aacaataaaa cgaaaacaca agttaaaaa
Database: dmel_all_transcript_r320
>CG5889-RA type=mRNA;
loc= 3R:join (22966728..22966993,22969303..22969477,
22969543..22970592,22970653..22970805,22970865..22971159,
22971228..22971356,22971427..22972693); ID=Mdh-RA;
name=Mdh-RA; db_xref='CG5889,FlyBase:FBgn0029155';
len=3335
Length = 3335
Genome Map
Score = 621 bits (323), Expect = e-177
Identities = 323/323 (100%)
Strand = Plus / Plus
Query: 125 cgattccacatgtaaaacaacttaactcgctgccgttaaccaccaccaactatctaagtt 184
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3013 cgattccacatgtaaaacaacttaactcgctgccgttaaccaccaccaactatctaagtt 3072
Query: 185 agaacattatgctttctatcgattagttcacttatatctgtagatatattcgagcgacga 244
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3073 agaacattatgctttctatcgattagttcacttatatctgtagatatattcgagcgacga 3132
Query: 245 ttatgtttgttgtttagccatatctgatatttattaacgcaattaagcagctttgttata 304
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3133 ttatgtttgttgtttagccatatctgatatttattaacgcaattaagcagctttgttata 3192
Query: 305 atttattgttaaaaggtcgagcctaatgtatcagtaactagaaaacctaaccccttatga 364
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3193 atttattgttaaaaggtcgagcctaatgtatcagtaactagaaaacctaaccccttatga 3252
Query: 365 tcgatcggaccgattcagccattgtaccactgactagatgatgatgatgtgcgataaaca 424
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3253 tcgatcggaccgattcagccattgtaccactgactagatgatgatgatgtgcgataaaca 3312
Query: 425 ataaaacgaaaacacaagttaaa 447
|||||||||||||||||||||||
Sbjct: 3313 ataaaacgaaaacacaagttaaa 3335
Score = 112 bits (58), Expect = 3e-24
Identities = 65/66 (98%), Gaps = 1/66 (1%)
Strand = Plus / Plus
Query: 9 atcgattaccccc-tacaaaccgaccgcctagaacaattggctagacagcagagctaact 67
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2896 atcgattacccccctacaaaccgaccgcctagaacaattggctagacagcagagctaact 2955
Query: 68 ggtgag 73
||||||
Sbjct: 2956 ggtgag 2961
\#
anon- EST:Posey83  = ?
>anon- EST:Posey83 
gcgcgaggtn cccaacgcct tttcctcatt tggcgcacca caaaagcgga aagcgaccac
agagccccaa gcacactgag attgccggag acaaccanca gccaagtctg aagccaaaat
cgaatcgaag tcctaancga atatcaaatc caagcccaaa accaaancct actattaaca
aatagccnat agcgaggagt tcacgaagga gtcctgcaaa cacatccttt caacacagtg
caagctcgcc attttgtgtt ttttcgaaat agaaaaagtt tttaaaagcc ataccgcaag
attctgcatt aaatatatac acacatatat ttatatttcc atttttccgt gcgtatacgt
gatctgcgtc gaagtcagtt cattctgtcc atgatttaca aatatattta tacataatty
gccactgaga gaaccgcgaa gtgtaragtg caagtgaagt tcagtattat ttacaaggcg
tgaaaatcga aaaagtttac accaaatatt ctgctcaaga actcactact caragtagtc
caaggattcc agtctctcag cgcaacaatt gtcagcgaaa attcctacga atcttagcca
gctaaaaact ctaattraag tcagacgaaa gcacaactac raagggttaa aaactctgaa
agcaagaaag aaattaacta aatattaaag gaatcttcga agtgaacacc aaagcaaaga
tctacagtat tattttgaat aagaaatata taaaacacac tctaagcgat aaatagagac
aataaagttg aaataaaaaa accaaattaa atttgtgact ctagcctaaa agtaaacaca
tanaccctag cttaatt
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003567 |gb|AE003567| arm:3L  5083015..5237352
estimated- cyto:64C9-64C12  gadfly- seqname:AE003567 
 seq_release:3 
Length = 154338
Score = 1513 bits (785), Expect = 0.0 Genome Map
Identities = 820/845 (97%), Gaps = 1/845 (0%)
Strand = Plus / Minus
Query: 14 aacgccttttcctcatttggcgcaccacaaaagcggaaagcgaccacagagccccaagca 73
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 149622 aacgccttttcctcattttgcgcaccacaaaagcggaaagcgaccacagagccccaagca
149563
Query: 74 cactgagattgccggagacaaccancagccaagtctgaagccaaaatcgaatcgaagtcc 133
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 149562 cactgagattgccggagacaaccaacagccaagtctgaagccaaaatcgaatcgaagtcc
149503
Query: 134 taancgaatatcaaatccaagcccaaaaccaaancctactattaacaaatagccnatagc 193
||| |||||||||||| |||||||||||||||| |||||||||||||||||||| |||||
Sbjct: 149502 taatcgaatatcaaattcaagcccaaaaccaaatcctactattaacaaatagccaatagc
149443
Query: 194 gaggagttcacgaaggagtcctgcaaacacatcctttcaacacagtgcaagctcgccatt 253
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 149442 gaggagttcacgaaggagtcctgcaaacacatcctttcaacacagtgcaagctcgccatt
149383
Query: 254 ttgtgttttttcgaaatagaaaaagtttttaaaagccataccgcaagattctgcattaaa 313
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 149382 ttgtgttttttcgaaatagaaaaagtttttaaaagccataccgcaagattctgcattaaa
149323
Query: 314 tatatacacacatatatttatatttccatttttccgtgcgtatacgtgatctgcgtcgaa 373
|||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 149322 tatatacatacatatatttatatttccatttttccgtgcgtatacgtaatctgcgtcgaa
149263
Query: 374 gtcagttcattctgtccatgatttacaaatatatttatacataattygccactgagagaa 433
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 149262 gtcagttcattctgtccatgatttacaaatatatttatacataattagccactgagagaa
149203
Query: 434 ccgcgaagtgtaragtgcaagtgaagttcagtattatttacaaggcgtgaaaatcgaaaa 493
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 149202 ccgcgaagtgtaaagtgcaagtgaagttcagtattatttacaaggcgtgaaaatcgaaaa
149143
Query: 494 agtttacaccaaatattctgctcaagaactcactactcaragtagtccaaggattccagt 553
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 149142 agtttacaccaaatattctgctcaagaactcactactcaaagtagtccaaggattccagt
149083
Query: 554 ctctcagcgcaacaattgtcagcgaaaattcctacgaatcttagccagctaaaaactcta 613
||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||
Sbjct: 149082 ctctcagcgcaacaattgtcagcgaaaattcctacgaatcttagccaactaagaactcta
149023
Query: 614 attraagtcagacgaaagcacaactacraagggttaaaaactctgaaagcaagaaagaaa 673
||| ||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||
Sbjct: 149022 attaaagtcagacgaaagcacaactacaaagggttaaaaactctgaaagtaagaaagaaa
148963
Query: 674 ttaactaaatattaaaggaatcttcgaagtgaacaccaaagcaaagatctacagtattat 733
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148962 ttaactaaatattaaaggaatcttcgaagtgaacaccaaagcaaagatctacagtattat
148903
Query: 734 tttgaataagaaatatataaaacacactctaagcgataaatagagacaataaagttgaaa 793
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148902 tttgaataagaaatatataaaacacactctaagcgataaatagagacaataaagttgaaa
148843
Query: 794 t-nnnnnnnccaaattaaatttgtgactctagcctaaaagtaaacacatanaccctagct 852
| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 148842 taaaaaaaaccaaattaaatttgtgactctagcctaaaagtaaacacataaaccctagct
148783
Query: 853 taatt 857
|||||
Sbjct: 148782 taatt 148778
\#
anon- EST:Posey9  = CG9325
>anon- EST:Posey9 
ggcacgaggg taaagcaaat gaacagataa aaaagggtac aaattcccag gcaactctaa
cgacaaacaa agatttgttt gaaacaaagg caaacttttg tttttagaca catacgtaca
agcgtggtac atgcataata cttaaatgca atattttttt agaaatgcaa taaattcgat
gacaacaact acaatttgat attctaggca tgtgtgtgtt ttgtgaaagc gcgttttatg
tttttgtgtn ctttngtttn gttttnaaat tccgggcagc cacaatttgc acacaaaaca
aataaataat tattgtatac atgcagcaat tgtattagtt ttttatataa ataattatat
atttttatgt acgtaaaact gtttatacat acatatacat atatatattt ataaaaacca
ataaattatg aagaaaacga aaatccaaaa atacaccacg cccgcattaa aacatgcgat
tantctgagg aaagcagaaa caacacnatc actgagaatg gttggaattt tccaaaaatt
atctccaaga atcaaatttc agcatttctt ttgtaagtag atgtgcttga tttgtaatcg
cttttccatt tataatattc aaatcgatga ataacgaata ctgcacatta actatatacg
actgccatag catgtaaaac tttaaggcac aacttaaacg catttacatt tcaaattaac
tgacataaaa ttaaaacccc gatgattaat gccagataaa tcgaatgttt ctgcttttcc
tacccaaacc caccacca
Database: dmel_all_transcript_r320
>CG9325-RF type=mRNA;
loc= 2R:complement (14461055..14462519,14462746..14462813,
14471561..14471632,14471695..14471775,14471844..14472138,
14472203..14472313,14473340..14473463,14473525..14474236,
14474310..14474793,14474880..14474991,14482277..14482325,
14487314..14487814); ID=hts-RF; name=hts-RF;
db_xref='CG9325,FlyBase:FBgn0004873'; len=4074
Length = 4074
Genome Map
Score = 717 bits (373), Expect = 0.0
Identities = 382/385 (99%), Gaps = 1/385 (0%)
Strand = Plus / Plus
Query: 414 aaaaccaataaattatgaagaaaacgaaaatccaaaaatacaccacgcccgcattaaaac 473
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3627 aaaaccaataaattatgaagaaaacgaaaatccaaaaatacaccacgcccgcattaaaac 3686
Query: 474 atgcgattantctgaggaaagcagaaacaacacnatcactgagaatggttggaattttcc 533
||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 3687 atgcgattactctgaggaaagcagaaacaacacaatcactgagaatggttggaattttcc 3746
Query: 534 aaaaattatctccaagaatcaaatttcagcatttcttttgtaagtagatgtgcttgattt 593
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3747 aaaaattatctccaagaatcaaatttcagcatttcttttgtaagtagatgtgcttgattt 3806
Query: 594 gtaatcgcttttccatttataatattcaaatcgatgaataacgaatactgcacattaact 653
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 3807 gtaatcgcttttccatttataatattcaaatcgatgaataacgaatactgca-attaact 3865
Query: 654 atatacgactgccatagcatgtaaaactttaaggcacaacttaaacgcatttacatttca 713
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3866 atatacgactgccatagcatgtaaaactttaaggcacaacttaaacgcatttacatttca 3925
Query: 714 aattaactgacataaaattaaaaccccgatgattaatgccagataaatcgaatgtttctg 773
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3926 aattaactgacataaaattaaaaccccgatgattaatgccagataaatcgaatgtttctg 3985
Query: 774 cttttcctacccaaacccaccacca 798
|||||||||||||||||||||||||
Sbjct: 3986 cttttcctacccaaacccaccacca 4010
Score = 404 bits (210), Expect = e-112
Identities = 217/224 (96%)
Strand = Plus / Plus
Query: 9 ggtaaagcaaatgaacagataaaaaagggtacaaattcccaggcaactctaacgacaaac 68
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3222 ggtaaagcaaatgaacagataaaaaagggtacaaattcccaggcaactctaacgacaaac 3281
Query: 69 aaagatttgtttgaaacaaaggcaaacttttgtttttagacacatacgtacaagcgtggt 128
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3282 aaagatttgtttgaaacaaaggcaaacttttgtttttagacacatacgtacaagcgtggt 3341
Query: 129 acatgcataatacttaaatgcaatannnnnnnagaaatgcaataaattcgatgacaacaa 188
||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 3342 acatgcataatacttaaatgcaatatttttttagaaatgcaataaattcgatgacaacaa 3401
Query: 189 ctacaatttgatattctaggcatgtgtgtgttttgtgaaagcgc 232
||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3402 ctacaatttgatattctaggcatgtgtgtgttttgtgaaagcgc 3445
Score = 162 bits (84), Expect = 5e-39
Identities = 86/87 (98%)
Strand = Plus / Plus
Query: 267 aaattccgggcagccacaatttgcacacaaaacaaataaataattattgtatacatgcag 326
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 3480 aaattccgggcagccacaatttgcacacaaaacgaataaataattattgtatacatgcag 3539
Query: 327 caattgtattagttttttatataaata 353
|||||||||||||||||||||||||||
Sbjct: 3540 caattgtattagttttttatataaata 3566
\#
anon- EST:Posey93  = end of dlg1 ?
>anon- EST:Posey93 
ggcacgaggt tgcggtctaa ttttatacac accagacaaa tcgaattgca aataaataaa
taattaagaa agtgacaatg gagaagcaga gctggagatg agatcaactc aaactagata
actatacata tatttgctga ttaatttatg taaaccaata tacgatttat agccaacgca
cagaaaatga aaaacaaaaa aaagcaacac atacgaaatt tgttcgaaaa aatttagcta
aattcaagtt gagtgttaac attataattc atgcgaatat gcatatattc aatttttttt
tttaactctc catctctcct gctcgccatt atacgaacta cttaaaacat ttttttttaa
ttaaattttt tgtatattgc aaaaacgtcg acgacgccac agcagcagca gctatggata
ttatttcaaa aatatataca tataactatt atacgaataa agagaaaaca aattcattat
aattttcaca atgtatgcgc cgagagcatt gtatatttaa taaacaacct aaacaaaagg
acaaacatgg aaacaaataa aactatgcga ataatttcac tctaacaaaa tgcaaacaag
caaccaaaaa
Database: dmel_all_scaffolds_r310
>gadfly| SEG:AE003486 |gb|AE003486| arm:X  11111476..11439603
estimated- cyto:10B6-10D5  gadfly- seqname:AE003486 
 seq_release:3 
Length = 328128
Score = 858 bits (446), Expect = 0.0 Genome Map
Identities = 545/597 (91%), Gaps = 9/597 (1%)
Strand = Plus / Plus
Query: 9 gttgcggtctaattttatacacaccagacaaatcgaattgcaaataaataaataattaag 68
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 38275 gttgcggtctaattttatacacaccagacaaatcgaattgcaaataaataaataattaag 38334
Query: 69 aaagtgacaatggagaagcagagctggagatgagatcaactcaaactagataactataca 128
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 38335 aaagtgacaatggagaagcagagctggagatgagatcaactcaaactagataactataca 38394
Query: 129 tatatttgctgattaatttatgtaaaccaatatacgatttatagccaacgcacagnnnnn 188
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 38395 tatatttgctgattaatttatgtaaaccaatatacgatttatagccaacgcacagaaaat 38454
Query: 189 nnnnnnnnnnnnnnngcaacacatacgaaatttgttcgaaaaaatttagctaaattcaag 248
|||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 38455 gaaaaacaaaaaaaagcaatacatacgaaatttgttcgaaaaaatttagctaaattcaag 38514
Query: 249 ttgagtgttaacattataattcatgcgaatatgcatatattcaannnnnnnnnnnaactc 308
|||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 38515 ttgagtgttaacattataattcatgcgaatatgcatatattcaatttttttttttaactc 38574
Query: 309 tccatctctcctgctcgccattatacgaactacttaaaacannnnnnnnnaattaaattt 368
||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 38575 tccatctctcctgctcgccattatacgaactacttaaaacatttttttttaattaaattt 38634
Query: 369 tttgtatattgcaaaaacgtcgacgacgccacagcagcagcagctatggatattatttca 428
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 38635 tttgtatattgcaaaaacgtcgacgacgccacagcagcagcagctatggatattatttca 38694
Query: 429 aaaatatatacatataactattatacgaataaagagaaaacaaattcattataattttca 488
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 38695 aaaatatatacatataactattatacgaataaagagaaaacaaattcattataattttca 38754
Query: 489 caatgtatgcgccgagagcattg-tatatttaataaacaacctaaa--caaaaggacaaa 545
||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 38755 caatgtatgcgccgagagcattgttatatttaataaacaacctaaaacaaaaaggacaaa 38814
Query: 546 c-atgg-aaacaaa--taaaactatgcgaataattt-cactct-aacaaaatgcaaa 596
| |||| ||||||| ||||||||||||||||||| |||||| |||||||||||||
Sbjct: 38815 caatggaaaacaaaataaaaactatgcgaataatttccactctaaacaaaatgcaaa 38871
Score = 33.4 bits (17), Expect = 6.8 Genome Map
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 428 aaaaatatatacatata 444
|||||||||||||||||
Sbjct: 148756 aaaaatatatacatata 148772
\#
anon- EST:PoseyA1  = qbert
>anon- EST:PoseyA1 
ggcacgagag aatctgtatg cttaatctca accttcaggt tttatagatc ctgagatctc
gactttcata gggacagaca tggccagatc gacttggcta ttcatcctga tcaagaatat
atattctcta tgtggtcaga aacgcttcct tctgcctgtt acataaggca attttgccga
ttgctcatat atttacaatc gtacacattc gggtacaagc cgaaccctgc gttgtccata
cacagtctct gcagaattac tatcatcttt ttcagtttat tttttaaatt ttcaatatca
tttgaaaata tatgcttctt acccgttact tgtagagtaa aagggtagag aaggaagcgt
ttccgactac atgtagtatt tatattcttg atcaggatta acagcaaagt cgatcttacc
ctctcagccg gtcaacggac aagggattaa caatgcccac ttcgcttatc gttctaattc
taaagaggta ttgaacatgt gacggcagtg gttgtgggga ttttattagt gagtggtgaa
atagaaagga attggataaa gcgtattgaa acataataac gtgcaagtgc aagtaaaaca
aaggaaacaa acgaaatcaa gttcaaattg cttcacaggc gaccgtatat gtgtacatca
aacgctgata aggcaccggg atcgcttgtg cgggacaatt tacaacaatt ataccaacaa
gttactgtgt gtgatgaccg tatatgtgta catcaatcgc tgataaggca ccgggatcat
ccatacaccc taact
Database: dmel_all_transposon_r320
>FBti0019900 type=transposable_element; loc= 2R:301100..308748 ; Genome Map
ID=FBti0019900; name=qbert{}625; map=41F1-41F1;
db_xref='qbert{}625,FlyBase:FBan0069900'; len=7649
Length = 7649
Score = 606 bits (315), Expect = e-173
Identities = 315/315 (100%)
Strand = Plus / Minus
Query: 481 taaagaggtattgaacatgtgacggcagtggttgtggggattttattagtgagtggtgaa 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 7390 taaagaggtattgaacatgtgacggcagtggttgtggggattttattagtgagtggtgaa 7331
Query: 541 atagaaaggaattggataaagcgtattgaaacataataacgtgcaagtgcaagtaaaaca 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 7330 atagaaaggaattggataaagcgtattgaaacataataacgtgcaagtgcaagtaaaaca 7271
Query: 601 aaggaaacaaacgaaatcaagttcaaattgcttcacaggcgaccgtatatgtgtacatca 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 7270 aaggaaacaaacgaaatcaagttcaaattgcttcacaggcgaccgtatatgtgtacatca 7211
Query: 661 aacgctgataaggcaccgggatcgcttgtgcgggacaatttacaacaattataccaacaa 720
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 7210 aacgctgataaggcaccgggatcgcttgtgcgggacaatttacaacaattataccaacaa 7151
Query: 721 gttactgtgtgtgatgaccgtatatgtgtacatcaatcgctgataaggcaccgggatcat 780
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 7150 gttactgtgtgtgatgaccgtatatgtgtacatcaatcgctgataaggcaccgggatcat 7091
Query: 781 ccatacaccctaact 795
|||||||||||||||
Sbjct: 7090 ccatacaccctaact 7076
Score = 79.5 bits (41), Expect = 4e-15
Identities = 43/44 (97%)
Strand = Plus / Minus
Query: 425 cagccggtcaacggacaagggattaacaatgcccacttcgctta 468
||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 7432 cagccggtcaacggacaagggattaacaatgcccactacgctta 7389
Score = 71.8 bits (37), Expect = 8e-13
Identities = 41/43 (95%)
Strand = Plus / Minus
Query: 736 gaccgtatatgtgtacatcaatcgctgataaggcaccgggatc 778
||||| ||||||| |||||||||||||||||||||||||||||
Sbjct: 6562 gaccgaatatgtgcacatcaatcgctgataaggcaccgggatc 6520
Score = 69.9 bits (36), Expect = 3e-12
Identities = 42/45 (93%)
Strand = Plus / Minus
Query: 640 cgaccgtatatgtgtacatcaaacgctgataaggcaccgggatcg 684
|||||| ||||||| ||||||| ||||||||||||||||||||||
Sbjct: 6563 cgaccgaatatgtgcacatcaatcgctgataaggcaccgggatcg 6519
Score = 60.3 bits (31), Expect = 2e-09
Identities = 39/43 (90%)
Strand = Plus / Minus
Query: 736 gaccgtatatgtgtacatcaatcgctgataaggcaccgggatc 778
||||| ||||||||||| ||||||||| ||||||||||| |||
Sbjct: 6367 gaccgaatatgtgtacaacaatcgctgttaaggcaccggtatc 6325
Score = 58.4 bits (30), Expect = 9e-09
Identities = 40/45 (88%)
Strand = Plus / Minus
Query: 640 cgaccgtatatgtgtacatcaaacgctgataaggcaccgggatcg 684
|||||| ||||||||||| ||| ||||| ||||||||||| ||||
Sbjct: 6368 cgaccgaatatgtgtacaacaatcgctgttaaggcaccggtatcg 6324
\#
anon- EST:CL1d7  = CG10391
>anon- EST:CL1d7 
ttgaaagaaa ctctnnnnaa atatncncct ctacctatta ttgaacncgt ttnccgcaaa
act
Database: dmel_all_transcript_r320
>CG10391-RA type=mRNA;
loc= 2L:complement (18629140..18629444,18629509..18629778,
18629838..18630068,18630121..18630302,18630364..18630480,
18630540..18631067); ID=Cyp310a1-RA; name=Cyp310a1-RA;
db_xref='CG10391,FlyBase:FBgn0032693'; len=1633
Length = 1633
Genome Map
Score = 75.7 bits (39), Expect = 3e-14
Identities = 51/61 (83%)
Strand = Plus / Plus
Query: 1 ttgaaagaaactctnnnnaaatatncncctctacctattattgaacncgtttnccgcaaa 60
|||||||||||||| |||||| | |||||||| |||||||||| |||| |||||||
Sbjct: 1052 ttgaaagaaactcttcgcaaatatccacctctacccattattgaacgtgtttgccgcaaa 1111
Query: 61 a 61
|
Sbjct: 1112 a 1112
\#
anon- EST:CLB3  = CG6736
>anon- EST:CLB3 
tgcttngaga gtaactttat ttncctccac tagaaatttt acaatgaaat atttggaaat
ncgattacgt ttatagttag tnnttaagtg tagtaggaaa atnaattgca aatngcct
Database: dmel_all_transcript_r320
>CG6736-RA type=mRNA;
loc= 3L:complement (9760920..9761415,9761477..9761807); Genome Map
ID=CG6736-RA; name=CG6736-RA;
db_xref='CG6736,FlyBase:FBgn0036048'; len=827
Length = 827
Score = 194 bits (101), Expect = 9e-50
Identities = 110/118 (93%)
Strand = Plus / Minus
Query: 1 tgcttngagagtaactttatttncctccactagaaattttacaatgaaatatttggaaat 60
||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 812 tgcttggagagtaactttatttgcctccactagaaattttacaatgaaatatttggaaat 753
Query: 61 ncgattacgtttatagttagtnnttaagtgtagtaggaaaatnaattgcaaatngcct 118
||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||
Sbjct: 752 acgattacgtttatagttaggggttaagtgtagtaggaaaatgaattgcaaatagcct 695
\#
DOI
Associated Information
Comments
Associated Files
Other Information
Secondary IDs
    Language of Publication
    English
    Additional Languages of Abstract
    Parent Publication
    Publication Type
    Abbreviation
    Title
    ISBN/ISSN
    Data From Reference