Home
Reference Report
| Reference | |||
|---|---|---|---|
| Citation | Kanagawa, S., Moore, A.W. (2004.11.18). A1-2-29 enhancer-trap line. (Export to RIS) | ||
| FlyBase ID | FBrf0183007 | ||
| Publication Type | Personal communication to FlyBase | ||
| External Crossreferences | |||
| PubMed ID | |||
| PubMed Abstract | |||
| BIOSIS ID | |||
| Zoological Record ID | |||
Recent Updates
|
|||
| Description |
What does this section display?
This section contains items that were added to this record for each release.
It currently only tracks new links between this FlyBase report and other
FlyBase data classes (e.g. genes, references, stocks) or controlled
vocabulary terms (e.g. GO, anatomy terms).
What does this section not display?
This section does not currently display links that were removed or gene model changes.
|
||
| Update Feed |
Click the icon below to subscribe to this FlyBase record and receive updates automatically through your
feed reader.
|
||
| FB2012_01 | |||
| FB2011_10 | |||
| All updates | Click here to see a list of all updates to this record from FB2010_08 and on. | ||
|
Associated Information
|
|||
| Comments | |||
| Text of Personal Communication |
Date: Thu, 18 Nov 2004 15:51:00 \+0900
To: flybase-updates@XXXXXXXXXXXXXXX From: Adrian Moore <adrianm@XXXXXXXXXXXXXXX> Subject: Unpublished Data Submission to FlyBase Cc: kanagawa@XXXXXXXXXXXXXXX Dear Sir, We would like to submit the data we have obtained for A1-2-29 enhancer-trap line to FlyBase, since we are not planning to publish the data. We rescued both 5' and 3' flanking genomic sequence of the pLacW insertion by plasmid rescue method and the details are shown below. Enhancer-trap line: A1-2-29 Reference: Hartenstein and Jan 1992, FBrf0057603 Insertion was found to be upstream of the gene Rapgap1 FBgn0014015 3' rescued sequence \+/- (starting at 2L: 7522842) CATGGGCAGAGGCAGCAAACAAC ATTGGATATTTTTCAGTTGCCGTTTCTCCGTTGCCGAAAGCAGACGTTTGAGCCGGTTTGAATTC 5' rescued sequence \+/+ (starting at 2L: 7522829) TGCCTCTGCCGATGCGTCTGTCG CTCTGCTCTGCCAACGCACAGTG GGCCAGACACAACAAGACTCGAT GTCTAAGAAAAGCGCATTTTGCG TACGTATGTTATCCATATGGGGA TTTGTAAAAATTTCTGTTATTTA TAACATACATTATTCTATTATATACAAAATGGTTTTTTGAGAAATTTA Reference for Rapgap1: Biological characterization of Drosophila Rapgap1, a GTPase activating protein for Rap1. Chen, F., et al. Proc. Natl. Acad. Sci. USA Vol. 94, pp. 12485-12490 1997 If you use this Information, please quote pers. comm. from: Kanagawa S. and Moore A.W. Regards Adrian Moore Dr Adrian Moore, Unit Leader, Molecular Neuropathology Group, RIKEN Brain Science Institute, 2-1 Hirosawa, Wako City, Saitama 351-0198 JAPAN Tel 048 467 7274 Fax 048 462 4796 |
||
| Associated Files | |||
|
Other Information
|
|||
| Secondary IDs | |||
| Language of Publication | English | ||
| Additional Languages of Abstract | |||
| ISBN | |||
|
Parent Publication
|
|||
| Publication Type | |||
| Abbreviation | |||
| Title | |||
| Editors | |||
| Publication Year | |||
| ISBN/ISSN | |||
|
Data from Reference
|
|||
| Genes (1)
|
|||
| Insertions (1)
|
|||