Open Close
Reference
Citation
Levis R., (2009.03.30). Additional mapped insertions (release 3 coordinates). 
FlyBase ID
FBrf0207436
Publication Type
Personal communication to FlyBase
Abstract
PubMed ID
PubMed Central ID
Text of Personal Communication
(Original communication received April 2006; addendum received 2009.03.30)
Line_ID	Chrom	Coord	Strand	Comment
BG00013	X	7443387	-1	
c00236-5prime	3L	12451304	-1	
c00428-3prime	2R	4931678	1	
c03279-5prime	2L	13252335	-1
c03323-5prime	3R	16154238	1	
c07050-5prime	3R	12898532	-1	
d02937-5prime	X	7064798	-1	
d06481-3prime	3R	11166385	-1	
EP(2)2171-3prime	2L	13886555	1	
EP(3)3236	3R	19675056	1
EP(X)0773	X	922535	1
EP(X)1507-3prime	X	11537818	-1	
EY00484-5prime	3R	5566658	-1
EY03167	3R	3916296	1	
EY04120	3R	1648213	-1	
EY04367-3prime	X	3536861	-1
EY05060-3prime	X	19806988	-1	
EY05584	X	2342128	-1	
EY05589	3L	15092903	1
f03024-3prime	3L	14894511	1	
f03296-5prime	2L	18157720	-1	
f03416-5prime	2L	2243942	-1	
f05203-3prime	3R	7898190	1	
f05960-5prime	3L	16529784	-1	
f06204-5prime	3R	24299634	-1
KG01223-3prime	3R	7356017	1
KG01438	3R	25574343	1	
KG01949	2L	15198205	-1	
KG04473-3prime	X	923102	-1	
KG05288-3prime	2L	20144111	1	
KG05308	2R	280598	1	
KG05827-5prime	2R	3004193	-1
KG05876	2L	20192931	-1	
KG05897-3prime	3R	27034852	1
KG06133-5prime	3L	23275414	-1
KG06805-5prime	2R	18566880	-1	
KG07625	2L	13233412	-1	
l(2)01092	2R	19895226	-1	1-76 is unique, remainder is TE Opus
l(2)02647-5prime	2L	6912945	1	
l(2)03068	2R	14823979	-1
l(2)06708-5prime	2L	12496810	-1	Curated alignment maps to different cytogenetic region than in situ in FlyBase
l(2)k05448	2L	12693322	-1	
l(2)s1878	2R	15326557	1	
l(3)07086-5prime	3R	16934641	-1	
l(3)07217-5prime	3L	1229403	1	 
Addendum. Additional flanking sequence data for EP(3)3236; insertion site at position 11:
>ep.3.323611, 329 bases.
GCGCTGGTGAGTCCTGACGAAGAGCGCAAGAAGAGGGTTCTTAACTTACA
TATACAAAAATACATATATACATACATTAAACAAAAGGCAAGAATATGAC
TTTCAAGGAATATCCCAGAATATAAAAATTTCCATGTCGATTATAACTTA
ACATCTCGTACTTAGATAGCAACATTTTTCTGCATTACCTAACGAAGTAA
TTTCATTAAAATAAAAATCGAAATCTCCAATTTAATAAATAGATATGTAT
GCATGAGTCGCTGGCTAAAAGGGTGAGGAGCAAACTAATCCATTTTTAAA
TGTTAATATACAGACCCGCATTAGAGATC  
DOI
Associated Information
Comments
Associated Files
Other Information
Secondary IDs
    Language of Publication
    English
    Additional Languages of Abstract
    Parent Publication
    Publication Type
    Abbreviation
    Title
    ISBN/ISSN
    Data From Reference