Reference Report
| Reference | |||
|---|---|---|---|
| Citation | Cook, K., Garton, R., Brown, A., Ward, M., Deal, J., Kaufman, T., Cook, K. (2010.10.12). Basal X chromosome segments present on Dp(1;Y)BSC chromosomes. (Export to RIS) | ||
| FlyBase ID | FBrf0212099 | ||
| Publication Type | Personal communication to FlyBase | ||
| PubMed ID | |||
| PubMed Abstract | |||
| Text of Personal Communication |
Basal X chromosome segments present on Dp(1;Y)BSC chromosomes
Kim Cook, Russell Garton, Adam Brown, Megan Ward, Jennifer Deal, Megan Deal, Thom Kaufman & Kevin Cook Bloomington Drosophila Stock Center Indiana University We have generated Y-linked duplications of X chromosomal segments by irradiating an attached-XY (C(1;Y)N12) with an inversion in the X chromosome. Irradiation produces a Dp(1;Y) chromosome by inducing a large deletion in the progenitor chromosome with one breakpoint within the inversion and another breakpoint in X heterochromatin or basal X euchromatin. The region distal to the deletion on a Dp(1;Y) consists of two parts: X tip genes distal to the inversion and genes from the middle of the X moved near the end of the X by the inversion. The distal and medial duplicated segments present on particular Dp(1;Y)BSC chromosomes have been described in other personal communications to FlyBase. The region of a Dp(1;Y) proximal to the deletion will carry no basal euchromatic genes if the proximal deletion breakpoint falls in X heterochromatin. When the proximal deletion breakpoint falls in basal X euchromatin, however, basal euchromatic genes will be present. This personal communication describes the basal X segments present on a group of Dp(1;Y)s. We mapped the distal extents of the basal segments to ~10 gene intervals defined by PCR primers using the following approach. Males carrying a Dp(1;Y) were crossed to females carrying a transposable element insertion in a basal X position. Primers flanking the insertion sites of the transposable elements were used to amplify fragments from DNA isolated from male progeny. With short extension times, fragments are amplified only if the site of the transposable element insertion is present on the Dp(1;Y). The following transposable elements and primer pairs were used in mapping: Insertion: P{SUPor-P}KG10095 Forward primer: GCATTGCCGACCTTTGAGCTGTGC (X:20631444..20631467) Reverse primer: GTTAAACCTGAATTGAGCATTGCTAGC (X:20632215..20632241) Insertion: P{SUPor-P}KG06210 Forward primer: GTGGATATGGATGTGTGGCAGG (X:20795940..20795961) Reverse primer: CTCCAATCCCACTTCCCTTTGTTGC (X:20796429..20796453) Insertion: P{SUPor-P}bvesKG09159 Forward primer: GATCACTGACAGCTCAATTAGCACTG (X:20942269..20942294) Reverse primer: CATTCGCACTCGAGAGCCATTGAACC (X:20943012..20943037) Insertion: P{GT1}BG02205 Forward primer: CTTGCATGTCCAACAACTTTACAGCC (X:21075861..21075886) Reverse primer: GTGATTGGTTGTTGTGTAAATGGGCC (X:21076293..21076318) Insertion: P{SUPor-P}CG33713KG06423 Forward primer: CTCGTTCTCGATCTTCTCCAGCGCGG (X:21189930..21189955) Reverse primer: GCAGCTTATGCTTACTAGACATCAGCG (X:21190646..21190672) Insertion: P{SUPor-P}slgAKG07965 Forward primer: CCTTTGCAGCTGCAACTGTCCGAGG (X:21253567..21253591) Reverse primer: CGGCTGGAAGTAAGTCTGCTCCG (X:21254094..21254116) Insertion: P{EPgy2}EY09781 Forward primer: CGCACAGGTCTTGAAGGCATTGCC (X:21443126..21443149) Reverse primer: GTTTCTAGCAGCCCCCTTCGCACCG (X:21443688..21443712) Insertion: P{Mae-UAS.6.11}CG14619GG01842 Forward primer: CATCGCTCGCGCGCACAATCTCGGC (X:21858117..21858141) Reverse primer: GTGCCGCCAGGCTGTCTACGCTCC (X:21858613..21858636) Insertion: P{GT1}BG01274 Forward primer: CTAGTGTATTTGCCTTCACCATAATCG (X:21961730..21961756) Reverse primer: GAGCGAGGAATATCTGATATGCGG (X:21962214..21962237) Insertion: PBac{WH}f02323 Forward primer: GATGGCGGTGTCCTTGTCTCTGGC (X:22366703..22366726) Reverse primer: CCTGTGACATTAATGCAGGCGACGG (X:22367213..22367237) The following basal segments are present on Dp(1;Y)s (Release 5 coordinates and predicted cytologies). These Dp(1;Y)s carry basal euchromatic genes: Dp(1;Y)BSC21 X:21443126--21858117;h28--h29 (20A3--20C1;h28--h29) Dp(1;Y)BSC22 X:21443126--21858117;h28--h29 (20A3--20C1;h28--h29) Dp(1;Y)BSC29 X:21443126--21858117;h28--h29 (20A3--20C1;h28--h29) Dp(1;Y)BSC30 X:21443126--21858117;h28--h29 (20A3--20C1;h28--h29) Dp(1;Y)BSC31 X:20631444--20795940;h28--h29 (19E2--19E5;h28--h29) Dp(1;Y)BSC39 X:21443126--21858117;h28--h29 (20A3--20C1;h28--h29) Dp(1;Y)BSC43 X:21443126--21858117;h28--h29 (20A3--20C1;h28--h29) Dp(1;Y)BSC47 X:21189930--21253567;h28--h29 (19F4--20A1;h28--h29) Dp(1;Y)BSC52 X:21443126--21858117;h28--h29 (20A3--20C1;h28--h29) Dp(1;Y)BSC53 X:21443126--21858117;h28--h29 (20A3--20C1;h28--h29) Dp(1;Y)BSC54 X:21443126--21858117;h28--h29 (20A3--20C1;h28--h29) Dp(1;Y)BSC60 X:21443126--21858117;h28--h29 (20A3--20C1;h28--h29) Dp(1;Y)BSC64 X:21075861--21189930;h28--h29 (19F2--19F4;h28--h29) Dp(1;Y)BSC71 X:21075861--21189930;h28--h29 (19F2--19F4;h28--h29) Dp(1;Y)BSC72 X:20795940--20942269;h28--h29 (19E5--19E7;h28--h29) Dp(1;Y)BSC85 X:21443126--21858117;h28--h29 (20A3--20C1;h28--h29) Dp(1;Y)BSC90 X:20942269--21075861;h28--h29 (19E7--19F2;h28--h29) Dp(1;Y)BSC100 X:21443126--21858117;h28--h29 (20A3--20C1;h28--h29) Dp(1;Y)BSC105 X:21443126--21858117;h28--h29 (20A3--20C1;h28--h29) Dp(1;Y)BSC109 X:21443126--21858117;h28--h29 (20A3--20C1;h28--h29) Dp(1;Y)BSC118 X:21443126--21858117;h28--h29 (20A3--20C1;h28--h29) Dp(1;Y)BSC120 X:21189930--21253567;h28--h29 (19F4--20A1;h28--h29) Dp(1;Y)BSC136 X:21858117--21961730;h28--h29 (20C1--20C3;h28--h29) Dp(1;Y)BSC140 X:21443126--21858117;h28--h29 (20A3--20C1;h28--h29) Dp(1;Y)BSC143 X:21443126--21858117;h28--h29 (20A3--20C1;h28--h29) Dp(1;Y)BSC149 X:21443126--21858117;h28--h29 (20A3--20C1;h28--h29) Dp(1;Y)BSC152 X:21443126--21858117;h28--h29 (20A3--20C1;h28--h29) Dp(1;Y)BSC156 X:21443126--21858117;h28--h29 (20A3--20C1;h28--h29) Dp(1;Y)BSC169 X:21443126--21858117;h28--h29 (20A3--20C1;h28--h29) PBac{WH}f02323, an insertion immediately distal to stnA in 20F3, was the most basal transposon insertion site we tested by PCR. The following Dp(1;Y)s do not carry this insertion site and, consequently, do not duplicate basal euchromatic genes distal to stnA. Dp(1;Y)BSC11 Dp(1;Y)BSC13 Dp(1;Y)BSC14 Dp(1;Y)BSC15 Dp(1;Y)BSC16 Dp(1;Y)BSC17 Dp(1;Y)BSC18 Dp(1;Y)BSC19 Dp(1;Y)BSC20 Dp(1;Y)BSC23 Dp(1;Y)BSC24 Dp(1;Y)BSC25 Dp(1;Y)BSC26 Dp(1;Y)BSC27 Dp(1;Y)BSC28 Dp(1;Y)BSC33 Dp(1;Y)BSC34 Dp(1;Y)BSC35 Dp(1;Y)BSC36 Dp(1;Y)BSC37 Dp(1;Y)BSC38 Dp(1;Y)BSC41 Dp(1;Y)BSC42 Dp(1;Y)BSC44 Dp(1;Y)BSC45 Dp(1;Y)BSC46 Dp(1;Y)BSC48 Dp(1;Y)BSC49 Dp(1;Y)BSC50 Dp(1;Y)BSC51 Dp(1;Y)BSC55 Dp(1;Y)BSC56 Dp(1;Y)BSC57 Dp(1;Y)BSC59 Dp(1;Y)BSC61 Dp(1;Y)BSC63 Dp(1;Y)BSC65 Dp(1;Y)BSC66 Dp(1;Y)BSC67 Dp(1;Y)BSC68 Dp(1;Y)BSC69 Dp(1;Y)BSC70 Dp(1;Y)BSC73 Dp(1;Y)BSC74 Dp(1;Y)BSC75 Dp(1;Y)BSC76 Dp(1;Y)BSC77 Dp(1;Y)BSC78 Dp(1;Y)BSC79 Dp(1;Y)BSC80 Dp(1;Y)BSC81 Dp(1;Y)BSC82 Dp(1;Y)BSC83 Dp(1;Y)BSC84 Dp(1;Y)BSC86 Dp(1;Y)BSC87 Dp(1;Y)BSC88 Dp(1;Y)BSC89 Dp(1;Y)BSC101 Dp(1;Y)BSC102 Dp(1;Y)BSC104 Dp(1;Y)BSC106 Dp(1;Y)BSC107 Dp(1;Y)BSC108 Dp(1;Y)BSC110 Dp(1;Y)BSC111 Dp(1;Y)BSC112 Dp(1;Y)BSC113 Dp(1;Y)BSC114 Dp(1;Y)BSC115 Dp(1;Y)BSC116 Dp(1;Y)BSC117 Dp(1;Y)BSC121 Dp(1;Y)BSC122 Dp(1;Y)BSC123 Dp(1;Y)BSC124 Dp(1;Y)BSC126 Dp(1;Y)BSC127 Dp(1;Y)BSC128 Dp(1;Y)BSC129 Dp(1;Y)BSC130 Dp(1;Y)BSC131 Dp(1;Y)BSC132 Dp(1;Y)BSC133 Dp(1;Y)BSC134 Dp(1;Y)BSC135 Dp(1;Y)BSC137 Dp(1;Y)BSC138 Dp(1;Y)BSC139 Dp(1;Y)BSC141 Dp(1;Y)BSC142 Dp(1;Y)BSC144 Dp(1;Y)BSC145 Dp(1;Y)BSC146 Dp(1;Y)BSC148 Dp(1;Y)BSC150 Dp(1;Y)BSC151 Dp(1;Y)BSC153 Dp(1;Y)BSC154 Dp(1;Y)BSC155 Dp(1;Y)BSC157 Dp(1;Y)BSC158 Dp(1;Y)BSC159 Dp(1;Y)BSC160 Dp(1;Y)BSC161 Dp(1;Y)BSC162 Dp(1;Y)BSC163 Dp(1;Y)BSC164 Dp(1;Y)BSC165 Dp(1;Y)BSC167 Dp(1;Y)BSC168 Dp(1;Y)BSC170 Dp(1;Y)BSC171 Dp(1;Y)BSC172 Dp(1;Y)BSC173 Dp(1;Y)BSC174 Dp(1;Y)BSC175 Dp(1;Y)BSC176 Dp(1;Y)BSC177 Dp(1;Y)BSC178 Dp(1;Y)BSC179 Dp(1;Y)BSC180 Dp(1;Y)BSC181 Dp(1;Y)BSC182 Dp(1;Y)BSC185 Dp(1;Y)BSC186 Dp(1;Y)BSC187 Dp(1;Y)BSC188 Dp(1;Y)BSC189 Dp(1;Y)BSC192 Dp(1;Y)BSC193 Dp(1;Y)BSC194 Dp(1;Y)BSC195 Dp(1;Y)BSC196 Dp(1;Y)BSC197 Dp(1;Y)BSC198 Dp(1;Y)BSC203 Dp(1;Y)BSC204 Dp(1;Y)BSC205 Dp(1;Y)BSC206 Dp(1;Y)BSC207 Dp(1;Y)BSC208 Dp(1;Y)BSC209 Dp(1;Y)BSC210 Dp(1;Y)BSC212 Dp(1;Y)BSC213 |
||
| DOI | |||
| Related Publication(s) | |||
Recent Updates
|
|||
| Description |
What does this section display?
This section contains items that were added to this record for each release.
It currently only tracks new links between this FlyBase report and other
FlyBase data classes (e.g. genes, references, stocks) or controlled
vocabulary terms (e.g. GO, anatomy terms).
What does this section not display?
This section does not currently display links that were removed or gene model changes.
|
||
| Update Feed |
Click the icon below to subscribe to this FlyBase record and receive updates automatically through your
feed reader.
|
||
| FB2013_03 | |||
| FB2013_02 | |||
| All updates | Click here to see a list of all updates to this record from FB2010_08 and on. | ||
Associated Information
|
|||
| Comments | |||
| Associated Files | |||
Other Information
|
|||
| Secondary IDs | |||
| Language of Publication | English | ||
| Additional Languages of Abstract | |||
| Also Published As | |||
Parent Publication
|
|||
| Publication Type | |||
| Abbreviation | |||
| Title | |||
| ISBN/ISSN | |||
Data from Reference
|
|||
Aberrations (175)
|
|||
|
|||
Recent Updates