Reference Report
| Reference | |||
|---|---|---|---|
| Citation | Schulte, J. (2011.9.16). P{UAS-Mob4.RNAi.JS1} construct and insertion. (Export to RIS) | ||
| FlyBase ID | FBrf0215601 | ||
| Publication Type | Personal communication to FlyBase | ||
| PubMed ID | |||
| PubMed Abstract | |||
| Text of Personal Communication |
The following information accompanied stocks donated to the Bloomington Stock Center by Joost Schulte, Massachusetts Institute
of Technology.
P{UAS-Mob4.RNAi.JS1} was generated in the lab of Norbert Perrimon as part of the TRiP Project. The Mob4 hairpin spans exons 1 and 2 and is 595 bp in length. PCR primers used to generate the hairpin construct are GCATACTACGGTGCAGGGAT (forward) and ACGACTCCTTGATGGACACC (reverse). Pupal lethality results when the construct is crossed to P{GAL4-da.G32}, actin-GAL4 or tubulin-GAL4. P{UAS-Mob4.RNAi.JS1}attP2 is a phiC31 integrase-mediated insertion into P{CaryP}attP2 at 68A4, 3L:11063638..11063638 (R5 flank). |
||
| DOI | |||
| Related Publication(s) | |||
Recent Updates
|
|||
| Description |
What does this section display?
This section contains items that were added to this record for each release.
It currently only tracks new links between this FlyBase report and other
FlyBase data classes (e.g. genes, references, stocks) or controlled
vocabulary terms (e.g. GO, anatomy terms).
What does this section not display?
This section does not currently display links that were removed or gene model changes.
|
||
| Update Feed |
Click the icon below to subscribe to this FlyBase record and receive updates automatically through your
feed reader.
|
||
| FB2013_03 | |||
| FB2013_02 | |||
| All updates | Click here to see a list of all updates to this record from FB2010_08 and on. | ||
Associated Information
|
|||
| Comments | |||
| Associated Files | |||
Other Information
|
|||
| Secondary IDs | |||
| Language of Publication | English | ||
| Additional Languages of Abstract | |||
| Also Published As | |||
Parent Publication
|
|||
| Publication Type | |||
| Abbreviation | |||
| Title | |||
| ISBN/ISSN | |||
Data from Reference
|
|||
Alleles (4)
|
|||
Constructs (4)
|
|||
Genes (2)
|
|||
Insertions (2)
|
|||
Natural transposons (1)
|
|||
Recent Updates