A Database of Drosophila Genes & Genomes

FB2013_03, released May 7th, 2013
 

Reference Report

Reference
Citation Schulte, J. (2011.9.16). P{UAS-Mob4.RNAi.JS1} construct and insertion.  (Export to RIS)
FlyBase ID FBrf0215601
Publication Type Personal communication to FlyBase
PubMed ID
PubMed Abstract
Text of Personal Communication
The following information accompanied stocks donated to the Bloomington Stock Center by Joost Schulte, Massachusetts Institute of Technology.
P{UAS-Mob4.RNAi.JS1} was generated in the lab of Norbert Perrimon as part of the TRiP Project.  The Mob4 hairpin spans exons 1 and 2 and is 595 bp in length. PCR primers used to generate the hairpin construct are GCATACTACGGTGCAGGGAT (forward) and ACGACTCCTTGATGGACACC (reverse). Pupal lethality results when the construct is crossed to P{GAL4-da.G32}, actin-GAL4 or tubulin-GAL4.
P{UAS-Mob4.RNAi.JS1}attP2 is a phiC31 integrase-mediated insertion into P{CaryP}attP2 at 68A4, 3L:11063638..11063638 (R5 flank).
DOI
Related Publication(s)
hide Recent Updates
Description
What does this section display?
This section contains items that were added to this record for each release. It currently only tracks new links between this FlyBase report and other FlyBase data classes (e.g. genes, references, stocks) or controlled vocabulary terms (e.g. GO, anatomy terms).
What does this section not display?
This section does not currently display links that were removed or gene model changes.
Update Feed
Click the icon below to subscribe to this FlyBase record and receive updates automatically through your feed reader.
FB2013_03
FB2013_02
All updates Click here to see a list of all updates to this record from FB2010_08 and on.
hide Associated Information
Comments
Associated Files
hide Other Information
Secondary IDs
Language of Publication English
Additional Languages of Abstract
Also Published As
hide Parent Publication
Publication Type
Abbreviation
Title
ISBN/ISSN
hide Data from Reference
hideAlleles (4)
hideConstructs (4)
hideGenes (2)
hideInsertions (2)
hideNatural transposons (1)