The following information accompanied stocks donated to the Bloomington Drosophila Stock Center by Helena Muster and Manfred Frasch, University of Erlangen-Nurnberg. CG9650B32 (a.k.a. Bcl11) is a CRISPR/Cas9-engineered deletion of most of the coding sequence in the last exon of CG9650 with flanking sequences AGGCCGGAAATGTAG ( X:7237633..7237647 , r6.4) and CTTAAGGAGGAGGCATGACTT ( X:7239885..7239905 , r6.4). This causes a frameshift, leading to the addition of a random polypeptide after the breakpoint.