Open Close
General Information
Symbol
Dmel\DRSC12796
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000012349
Collection
Associated gene
Genomic Location
Chromosome (arm)
3R
Sequence location

3R:10,587,841..10,588,075 [+]

Sequence Data
Length
235
Comments

One copy of repeat shown

GCTGTTGCACATTGCTGTTGCTGCTGCTGTTGCTGTTGCTGTTGCTGCTGCTGTTGCACATTGGGTGGCCCCACGAGCAA
CAAGGGCGACTGGCGGACATGGACAGTGGCAACGGCAGCAACCAGAGGGCGTTGCTTGTAAATGCCGGCGCTCATTTGTA
CATCCTGTTAAGCAAAACTTTTCGCAGCAGCAACATCGACTTTTCCCGCCCGTCCAACCTCACCCCTCCCTGGCA
Associated Information
Gene(s) (targeted or local)
    Allele(s)
      Transcripts(s)
        Polypeptide(s)
          Construct
            Experimental Data
            Progenitors
            PCR template

            genomic DNA

            Primer 1
            GCTGTTGCACATTGCTGT
            
            Primer 2
            TGCCAGGGAGGGGTGAG
            
            Comments
            Collection Information
            Collection: DRSC_dsRNA
            Symbol
            Title
            DRSC collection of dsRNA for RNAi in cell culture.
            Source and Progenitors
            Species of derivation
            D. melanogaster
            Strain of derivation
            Vector of progenitor construct
            Description

            Comprehensive collection of double-strand RNA fragments (1-2 dsRNAs per annotated gene), used for genome-wide RNAi-knockdown assays in cell culture.

            Additional data
            Sample preparation
            Collection preparation

            The DRSC RNAi screening library was constructed from genomic DNA amplified using Oregon-R strain. In initial collection, most amplicons were designed to FlyBase rel2 at R.Paro's lab (ZMBH Heidelberg). Primers were selected to target the open reading frames (ORF) of known and predicted genes. Regularly updated to accommodate newly identified genes and new gene models, and to replace amplicons with high potential for off-target effects.

            Mode of assay
            Data analysis
            Cell lines
            Observed in
            Not observed in
            Comments
            Stocks (0)
            External Crossreferences and Linkouts ( 1 )
            Crossreferences
            DRSC - Results frm RNAi screens
            Synonyms and Secondary IDs (2)
            Reported As
            Symbol Synonym
            DRSC12796
            HDC12872
            Secondary FlyBase IDs
            • FBri0012205
            References (1)