Open Close
General Information
Symbol
Dmel\DRSC27965
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000025535
Collection
Associated gene
Genomic Location
Chromosome (arm)
X
Sequence location

X:18,658,883..18,659,211 [+]

Sequence Data
Length
329
Comments

One copy of repeat shown

TGTTGAGCATCTTGAGACCGATGTGGAGGACAATATGCAACGTGTGGTCGTTCCCTTCGCGGACTTGTCCTACAGGGATC
TGTCTGGTGTTCGGGCAATGCCGATGGTACACCAGCCGGTGATCAACTCGCACACTTGCTTCGTCAGTGGCAACTCCAAT
ATGATCCTCAATCATATGAACGACAACTTCGACTTTCAGGCTTCCTTGCGGGGCGGAGGCGTGGCCGCTAAGCCAATAGT
CGCTCCAACCGTACGCCAGTCGCGCAGCAAGGATCTAGAGAAGCGTAAGCTTAGTCAGAATCTGGATAACTTCTCTGTTC
GCTTGGGTC
Associated Information
Gene(s) (targeted or local)
Allele(s)
    Transcripts(s)
      Polypeptide(s)
        Construct
          Experimental Data
          Progenitors
          PCR template

          genomic DNA

          Primer 1
          TGTTGAGCATCTTGAGACCG
          
          Primer 2
          GACCCAAGCGAACAGAGAAG
          
          Comments
          Collection Information
          Collection: DRSC_dsRNA
          Symbol
          Title
          DRSC collection of dsRNA for RNAi in cell culture.
          Source and Progenitors
          Species of derivation
          D. melanogaster
          Strain of derivation
          Vector of progenitor construct
          Description

          Comprehensive collection of double-strand RNA fragments (1-2 dsRNAs per annotated gene), used for genome-wide RNAi-knockdown assays in cell culture.

          Additional data
          Sample preparation
          Collection preparation

          The DRSC RNAi screening library was constructed from genomic DNA amplified using Oregon-R strain. In initial collection, most amplicons were designed to FlyBase rel2 at R.Paro's lab (ZMBH Heidelberg). Primers were selected to target the open reading frames (ORF) of known and predicted genes. Regularly updated to accommodate newly identified genes and new gene models, and to replace amplicons with high potential for off-target effects.

          Mode of assay
          Data analysis
          Cell lines
          Observed in
          Not observed in
          Comments
          Stocks (0)
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          DRSC - Results frm RNAi screens
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          Secondary FlyBase IDs
          • FBri0025218
          References (2)