Open Close
General Information
Symbol
Dmel\dsRNA-GD400
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000071237
Collection
Associated gene
Genomic Location
Chromosome (arm)
2L
Sequence location

2L:11,935,367..11,935,642 [+]

Sequence Data
Length
276
Comments
One copy of repeat shown
TCAACATTTCCATAACACTCATCAACATCCTGTTCTTTGCGGAAAACAACTTTGCAATGCTTTATTATGCGGTGTTCTTT
GCTGCAATGTTAATAGAACTATTTCCAAGTTGTTACTATGGAATTCTGATGACAATGGAGTTTGATAAGCTACCATATGC
CATCTTCTCCAGCAACTGGCTTAAAATGGATAAAAGATACAATCGATCCTTGATAATTCTGATGCAACTAACACTGGTTC
CAGTGAATATAAAAGCAGGTGGTATTGTTGGCATCG
Associated Information
Gene(s) (targeted or local)
Allele(s)
Transcripts(s)
    Polypeptide(s)
      Construct
      Experimental Data
      Progenitors
      PCR template
      genomic DNA
      Primer 1
      TCAACATTTCCATAACACTCATCAACATCCT
      
      Primer 2
      CGATGCCAACAATACCACCTGCTT
      
      Comments
      Collection Information
      Collection: VDRC-GD
      Symbol
      Title
      A set of transgenic RNAi constructs for expression of dsRNA under UAS control, VDRC first generation.
      Source and Progenitors
      Species of derivation
      D. melanogaster
      Strain of derivation
      Vector of progenitor construct
      Description
      Comprehensive collection of stocks carrying UAS-RNAi transgenes, each designed to target a single protein-coding gene.
      NOTE: Dataset members correspond to the amplicon sequence features; these can be used to retrieve associated constructs and stocks.
      Additional data
      Sample preparation
      Collection preparation
      A collection of over 13,200 RNAi transgenes (over 22,200 lines), each designed to target a single protein-coding gene; each construct contains short gene fragments cloned as inverted repeats that are expressed using the binary GAL4/UAS system. It is estimated that 88% of predicted protein-coding genes are targeted.
      Mode of assay
      Data analysis
      A specificity score (Q) was calculated for each construct, such that if Q is < 0.5, off-target effects are probable and if Q > 0.8, off-target effects are improbable.
      Cell lines
      Observed in
      Not observed in
      Comments
      Stocks (2)
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      dsRNA-GD400
      Secondary FlyBase IDs
      • FBri0067701
      References (1)