Sequence Feature: RNAi_reagent
| General Information | |||
|---|---|---|---|
| Symbol | dsRNA-GD12981 | Species | D. melanogaster |
| Feature type | RNAi_reagent | FlyBase ID | FBsf0000080946 |
| Collection | VDRC-1 | Associated gene(s) | GstD5 |
| Genomic Location | |||
| Chromosome (arm) | 3R | Sequence location | 3R:8,201,486..8,201,629 [+] |
Map ( GBrowse )
![]() |
|
||
Recent Updates
|
|||
| Description |
What does this section display?
This section contains items that were added to this record for each release.
It currently only tracks new links between this FlyBase report and other
FlyBase data classes (e.g. genes, references, stocks) or controlled
vocabulary terms (e.g. GO, anatomy terms).
What does this section not display?
This section does not currently display links that were removed or gene model changes.
|
||
| Update Feed |
Click the icon below to subscribe to this FlyBase record and receive updates automatically through your
feed reader.
|
||
| FB2013_03 | |||
| FB2013_02 | |||
| All updates | Click here to see a list of all updates to this record from FB2010_08 and on. | ||
Sequence Data
|
|||
| Length | 144 | ||
| Comments |
One copy of repeat shown
|
||
| Sequence | ATGGATTTCTATTACTCGCCCCGTGGAAGTGGATGTCGCACCGTGATCAT GGTGGCCAAGGCTCTCGGCGTGAAGCTGAACATGAAGCTACTGAACACCT TGGAGAAGGATCAGTTGAAGCCCGAGTTCGTCAAGCTCAATCCA |
||
Associated Information
|
|||
| Gene(s) (targeted or local) |
|||
| Allele(s) | |||
| Transcripts(s) |
|
||
| Polypeptide(s) |
|
||
| Construct | |||
Experimental Data
|
|||
Progenitors
|
|||
| PCR template |
cDNA
|
||
| Primer 1 |
ATGGATTTCTATTACTCGCCCCGTGG
|
||
| Primer 2 |
TGGATTGAGCTTGACGAACTCGGGC
|
||
| Comments | |||
Collection Information
|
|||
Collection: VDRC-1
|
|||
| Symbol | VDRC-1 | ||
| Source and Progenitors | |||
| Species of derivation | D. melanogaster | ||
| Strain of derivation | |||
| Vector or progenitor construct | |||
| Description | |||
|
Comprehensive collection of stocks carrying UAS-RNAi transgenes, each designed to target a single protein-coding gene.
|
|||
| Additional data | |||
|
A collection of over 13,200 RNAi transgenes (over 22,200 lines), each designed to target a single protein-coding gene; each
construct contains short gene fragments cloned as inverted repeats that are expressed using the binary GAL4/UAS system. It
is estimated that 88% of predicted protein-coding genes are targeted.
|
|||
| Cell lines | |||
| Observed in | |||
| Not observed in | |||
Comments
|
|||
Stocks Listed in FlyBase
( 2 )
|
|||
| VDRC |
v35659
v35660
|
||
External Crossreferences & Linkouts
|
|||
Synonyms & Secondary IDs
( 2 )
|
|||
| Reported As | |||
| Symbol Synonym |
12981
dsRNA-GD12981
|
||
| Secondary FlyBase IDs | |||
|
|||
References
( 1 )
|
|||
| Supplementary material |
|
||

Recent Updates
Sequence Data