Sequence Feature: RNAi_reagent

General Information
Symbol	dsRNA-GD12981	Species	D. melanogaster
Feature type	RNAi_reagent	FlyBase ID	FBsf0000080946
Collection	VDRC-1	Associated gene(s)	GstD5
Genomic Location
Chromosome (arm)	3R	Sequence location	3R:8,201,486..8,201,629 [+]
Map ( GBrowse )
Recent Updates
Description	What does this section display? This section contains items that were added to this record for each release. It currently only tracks new links between this FlyBase report and other FlyBase data classes (e.g. genes, references, stocks) or controlled vocabulary terms (e.g. GO, anatomy terms). What does this section not display? This section does not currently display links that were removed or gene model changes.
Update Feed	Click the icon below to subscribe to this FlyBase record and receive updates automatically through your feed reader.
FB2013_03
FB2013_02
All updates	Click here to see a list of all updates to this record from FB2010_08 and on.
Sequence Data
Length	144
Comments	One copy of repeat shown (Dietzl et al., 2007)
Sequence	ATGGATTTCTATTACTCGCCCCGTGGAAGTGGATGTCGCACCGTGATCAT GGTGGCCAAGGCTCTCGGCGTGAAGCTGAACATGAAGCTACTGAACACCT TGGAGAAGGATCAGTTGAAGCCCGAGTTCGTCAAGCTCAATCCA
Associated Information
Gene(s) (targeted or local)	GstD5
Allele(s)	GstD5^GD12981
Transcripts(s)
Polypeptide(s)
Construct	P{GD12981}
Experimental Data
Progenitors
PCR template	cDNA (Dietzl et al., 2007)
Primer 1	ATGGATTTCTATTACTCGCCCCGTGG (Dietzl et al., 2007)
Primer 2	TGGATTGAGCTTGACGAACTCGGGC (Dietzl et al., 2007)
Comments
Collection Information
Collection: VDRC-1
Symbol	VDRC-1
Source and Progenitors
Species of derivation	D. melanogaster
Strain of derivation

Vector or progenitor construct	pP{MF3} (Dietzl et al., 2007)
Description
	Comprehensive collection of stocks carrying UAS-RNAi transgenes, each designed to target a single protein-coding gene. (Dietzl et al., 2007)
Additional data
	A collection of over 13,200 RNAi transgenes (over 22,200 lines), each designed to target a single protein-coding gene; each construct contains short gene fragments cloned as inverted repeats that are expressed using the binary GAL4/UAS system. It is estimated that 88% of predicted protein-coding genes are targeted. (Dietzl et al., 2007)
Cell lines
Observed in
Not observed in
Comments

Stocks Listed in FlyBase ( 2 )
VDRC	v35659 w¹¹¹⁸; P{GD12981}v35659 v35660 w¹¹¹⁸; P{GD12981}v35660
External Crossreferences & Linkouts

Synonyms & Secondary IDs ( 2 )
Reported As
Symbol Synonym	12981 (Dietzl et al., 2007) dsRNA-GD12981
Secondary FlyBase IDs
	FBri0079060
References ( 1 )
Supplementary material	Dietzl et al., 2007, Nature 448(7150): Supplementary Table 1. [FBrf0202579]