Open Close
General Information
Symbol
Dmel\dsRNA-JF01931
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000086114
Collection
Associated gene
Genomic Location
Chromosome (arm)
2L
Sequence location

2L:9,772,597..9,773,006 [-]

Sequence Data
Length
410
Comments

One copy of repeat shown.

CATGTTCAGGCCCAACAGATGGCCACCACCGCCATTCACAGACGCAGTCATCCGATGCACAACCATTCACACAATCCCAT
CCAGCCGCAACATCGATTTCGCCAGATAGGCGAATGGTTCACCGAGAACATGCGCAACTACTGCCAGACCACGTCCCTTC
ACGGATTCAGTTACATCACCCGACAGGACATCAGTCGCCATGAGCGTTGGTTTTGGCTAGTGGTCGTGATCCTGGCCATC
ATCACCTCCATTGTGCTGGTGGTGGTGTCCTGGTACTGGAGCCAGGAAACGCCAACGGTCACAGTTATCGAAAGCTCGCA
CTTTCCGACATGGAATATTCCCTTTCCGGCTGTCACCATATGCAACTTTAATAAGATATCGAAAAGTAAAGCACTTAGCT
TGTTGGACCA
Associated Information
Gene(s) (targeted or local)
Allele(s)
Transcripts(s)
    Polypeptide(s)
      Construct
      Experimental Data
      Progenitors
      PCR template
      Primer 1
      CACCGAATTCATGTTCAGGCCCAACAGATG
      
      Primer 2
      TGGTCCAACAAGCTAAGTGCT
      
      Comments
      Collection Information
      Collection: TRiP-1
      Symbol
      Title
      A set of transgenic RNAi constructs for expression of dsRNA under UAS control, TRiP first generation (pVALIUM10).
      Source and Progenitors
      Species of derivation
      D. melanogaster
      Strain of derivation
      Vector of progenitor construct
      Description

      Collection of stocks carrying UAS-RNAi transgenes, each designed to target a single protein-coding gene; use a targeted insertion site.

      NOTE: Dataset members correspond to the amplicon sequence features; these can be used to retrieve associated constructs and stocks.

      A collection of first generation of UAS-driven long RNAi hairpin constructs cloned into derivatives of the VALIUM vector (Vermilion-AttB-Loxp-Intron-UAS-MCS) and targeted into the genome by the phiC31-mediated integration.

      Additional data
      Sample preparation
      Collection preparation

      The approach used by the TRiP is to generate transgenic animals with an RNAi hairpin under UAS-GAL4 control. The hairpin-containing transgenes are inserted via site-specific recombination into genomic loci known to be optimal for expression. This specific collection was constructed in the pVALIUM10 vector and inserted into the P{CaryP}attP2 target element.

      Primers for hairpin constructs were designed using the DRSC amplicon design tool SnapDragon (http://www.flyrnai.org/cgi-bin/RNAi_find_primers.pl). First, regions of 400-600bp that are free of EcoRI and XbaI restriction sites, and free of 19bp predicted off-target sites. If this was not possible, then regions without 20 or 21 bp matches to other genes were used. Primers were used to PCR amplify target DNA. Double-stranded RNA (dsRNA) hairpin constructs were cloned into the VALIUM10 vector, which allows for phiC31 targeted integration into the genome and Gal4-UAS inducible expression. Targeted transgene integration reduces the variability in hairpin expression resulting from random transgene integration.

      Mode of assay
      Data analysis
      Cell lines
      Observed in
      Not observed in
      Comments
      Stocks (1)
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      dsRNA-JF01931
      Secondary FlyBase IDs
        References (1)