Open Close
General Information
Symbol
Dmel\dsRNA-KK101252
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000087085
Collection
Associated gene
Genomic Location
Chromosome (arm)
2L
Sequence location

2L:10,998,195..10,998,771 [+]

Sequence Data
Length
577
Comments
One copy of repeat shown.
AGCGCTCTGGCAAGGTAATAACGTCATCGACTACAGTGCCCGGAACTGGGTTGCGATGCCCAGTAAAGTAGCGAGAATTA
ATGCGCTTGGATACAATTATAAATGTCATGCGACAGCCCTCCTGTTTGCCAGCTGATTTGTAAATTTCGTCGAGCCTGTC
CTTTAGGGTGTTCACCTCGCTGTTTACCACCTGGTAGAGCTGACCATCGCCAACACCGTCGCGAAAGAAGAGAATGCGCT
CTGGCAAAGAACGGTGTTGCTCCTGATACGACCTCAGGGCGCACGCCATGTTCACCGACATCTGCTCGGACAACTCTTGG
CCCTTAATGTGTTCGTTTACGGTGGAGAAGTAGCGGAAAGACTCCTTCTGGTCCATGGTTGCAACGAAAGCCCCATATGA
CTTGTTCTTATTCTTCGGTGAATGGCAGACATCGAAACCAACAGTCATCAGACCGTGGAGGGGGATCACTACCTGCCAGG
GAGCTCCCATCAATTTGGCGTTCATTTGAATAACCACCTTTGTGGCGATCGACATCAGCCCAGTTGGTTTTTGCTGTCGA
GGCGCGATAACTTTTAG
Associated Information
Gene(s) (targeted or local)
Allele(s)
Transcripts(s)
    Polypeptide(s)
      Construct
      Experimental Data
      Progenitors
      PCR template
      Primer 1
      AGCGCTCTGGCAAGGTAATA
      
      Primer 2
      CTAAAAGTTATCGCGCCTCG
      
      Comments
      Collection Information
      Collection: VDRC-KK
      Symbol
      Title
      A set of transgenic RNAi constructs for expression of dsRNA under UAS control, VDRC second generation.
      Source and Progenitors
      Species of derivation
      D. melanogaster
      Strain of derivation
      Vector of progenitor construct
      Description
      Collection of stocks carrying UAS-RNAi transgenes, each designed to target a single protein-coding gene; use a targeted insertion site.
      NOTE: Dataset members correspond to the amplicon sequence features; these can be used to retrieve associated constructs and stocks.
      Additional data
      Sample preparation
      Collection preparation
      The phiC31 RNAi library (KK) was created using the phiC31 integrase system to target RNAi transgenes to a specific landing site on the second chromosome. This insertion site (P{attP,y+,w3'}VIE-260B) was selected based on its low level of basal expression and consistent high level of GAL4-dependent expression across a range of different tissues. The RNAi transgenes consist of inverted repeats that were designed to reduce the risk of off-target effects.
      The host strain used for transgene integration actually has two landing sites: the annotated site in the 5' UTR of tio at R6:2L:22 ,019,296 (P{attP,y+,w3'}VIE-260B), and a previously non-annotated site at R6:2L:9437482 (P{attP,y+,w3'}VIE-260B-2). The previously non-annotated site seems to be the main integration site, occupied in all 39 lines tested. The originally annotated site was occupied in only 9 of 39 lines tested.
      Mode of assay
      Data analysis
      Cell lines
      Observed in
      Not observed in
      Comments
      Stocks (1)
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      dsRNA-KK101252
      Secondary FlyBase IDs
        References (1)