Sequence Feature: RNAi_reagent
| General Information | |||
|---|---|---|---|
| Symbol | dsRNA-KK112445 | Species | D. melanogaster |
| Feature type | RNAi_reagent | FlyBase ID | FBsf0000094196 |
| Collection | VDRC-2 | Associated gene(s) | CG42335 |
| Genomic Location | |||
| Chromosome (arm) | 3R | Sequence location | 3R:17,594,475..17,594,608 [+] |
Map ( GBrowse )
![]() |
|
||
Recent Updates
|
|||
| Description |
What does this section display?
This section contains items that were added to this record for each release.
It currently only tracks new links between this FlyBase report and other
FlyBase data classes (e.g. genes, references, stocks) or controlled
vocabulary terms (e.g. GO, anatomy terms).
What does this section not display?
This section does not currently display links that were removed or gene model changes.
|
||
| Update Feed |
Click the icon below to subscribe to this FlyBase record and receive updates automatically through your
feed reader.
|
||
| FB2013_03 | |||
| FB2013_02 | |||
| All updates | Click here to see a list of all updates to this record from FB2010_08 and on. | ||
Sequence Data
|
|||
| Length | 134 | ||
| Comments |
One copy of repeat shown.
|
||
| Sequence | CAGCTGCACGAGAGACTACGAAACCCATTACCACAAGATGATCATCTCTG GTACGGAAAGTGTTGAACAAAAGAAAATTGGTATCGCCCGTATGTACGAG GAGAATCCTGACTTGGTTCAGGCAATTTTCGAAA |
||
Associated Information
|
|||
| Gene(s) (targeted or local) |
|||
| Allele(s) | |||
| Transcripts(s) |
|
||
| Polypeptide(s) |
|
||
| Construct | |||
Experimental Data
|
|||
Progenitors
|
|||
| PCR template |
genomic
|
||
| Primer 1 |
CAGCTGCACGAGAGACTACG
|
||
| Primer 2 |
TTTCGAAAATTGCCTGAACC
|
||
| Comments | |||
Collection Information
|
|||
Collection: VDRC-2
|
|||
| Symbol | VDRC-2 | ||
| Source and Progenitors | |||
| Species of derivation | D. melanogaster | ||
| Strain of derivation | |||
| Vector or progenitor construct | |||
| Description | |||
|
Collection of stocks carrying UAS-RNAi transgenes, each designed to target a single protein-coding gene; use a targeted insertion
site.
|
|||
| Additional data | |||
|
The phiC31 RNAi library (KK) was created using the phiC31 integrase system to target RNAi transgenes to a specific landing
site on the second chromosome. This insertion site (P{attP,y[+],w[3']}VIE-260B) was selected based on its low level of basal expression and consistent high level of GAL4-dependent expression across a
range of different tissues. The RNAi transgenes consist of inverted repeats that were designed to reduce the risk of off-target
effects.
|
|||
| Cell lines | |||
| Observed in | |||
| Not observed in | |||
Comments
|
|||
Stocks Listed in FlyBase
( 1 )
|
|||
| VDRC |
v106552
|
||
External Crossreferences & Linkouts
|
|||
Synonyms & Secondary IDs
( 2 )
|
|||
| Reported As | |||
| Symbol Synonym |
112445
dsRNA-KK112445
|
||
| Secondary FlyBase IDs | |||
|
|
|||
References
( 1 )
|
|||
| Personal communication to FlyBase |
|
||

Recent Updates
Sequence Data