A Database of Drosophila Genes & Genomes

FB2013_03, released May 7th, 2013
 

Sequence Feature: RNAi_reagent

General Information
Symbol dsRNA-KK113173 Species D. melanogaster
Feature type RNAi_reagent FlyBase ID FBsf0000094699
Collection VDRC-2   Associated gene(s) CG9812
Genomic Location
Chromosome (arm) 2R Sequence location 2R:19,302,054..19,302,175 [+]
Map ( GBrowse ) GBrowse View Help detailed view FBtr0072016 FBtr0306150 FBtr0072025 FBsf0000004401 FBsf0000003856 FBsf0000094699 FBsf0000409804 FBsf0000411052 FBsf0000413313 FBsf0000387483 FBsf0000386964
hide Recent Updates
Description
What does this section display?
This section contains items that were added to this record for each release. It currently only tracks new links between this FlyBase report and other FlyBase data classes (e.g. genes, references, stocks) or controlled vocabulary terms (e.g. GO, anatomy terms).
What does this section not display?
This section does not currently display links that were removed or gene model changes.
Update Feed
Click the icon below to subscribe to this FlyBase record and receive updates automatically through your feed reader.
FB2013_03
FB2013_02
All updates Click here to see a list of all updates to this record from FB2010_08 and on.
hide Sequence Data
Length 122
Comments
One copy of repeat shown.
Sequence
TTGACCTTTTGGATGTGGCTGGTGACGACGGGGCCGGTGGTGGGTGAGAC
GGGCACAGGATCAGCAGGATATGCCGGCTGGACTGAGTGCTGCGAGGAGG
AGATCACAGTGCGACCAGGACT
hide Associated Information
Gene(s)
(targeted or local)
Allele(s)
Transcripts(s)
Polypeptide(s)
Construct
hide Experimental Data
hide Progenitors
PCR template
Primer 1
TTGACCTTTTGGATGTGGCT
Primer 2
AGTCCTGGTCGCACTGTGAT
Comments
hide Collection Information
hide Collection: VDRC-2
Symbol VDRC-2
Source and Progenitors
Species of derivation D. melanogaster  
Strain of derivation
Vector or progenitor construct
Description
Collection of stocks carrying UAS-RNAi transgenes, each designed to target a single protein-coding gene; use a targeted insertion site.
Additional data
The phiC31 RNAi library (KK) was created using the phiC31 integrase system to target RNAi transgenes to a specific landing site on the second chromosome. This insertion site (P{attP,y[+],w[3']}VIE-260B) was selected based on its low level of basal expression and consistent high level of GAL4-dependent expression across a range of different tissues. The RNAi transgenes consist of inverted repeats that were designed to reduce the risk of off-target effects.
Cell lines
Observed in
Not observed in
hide Comments
hide Stocks Listed in FlyBase ( 1 )
VDRC
hide External Crossreferences & Linkouts
hide Synonyms & Secondary IDs ( 2 )
Reported As
Symbol Synonym
dsRNA-KK113173
 
Secondary FlyBase IDs
    hide References ( 1 )
    Personal communication to FlyBase
    Keleman et al., 2009.8.5, RNAi-phiC31 construct and insertion data submitted by the Vienna Drosophila RNAi Center
    RNAi-phiC31 construct and insertion data submitted by the Vienna Drosophila RNAi Center [FBrf0208510]