Sequence Feature: RNAi_reagent

Help Close All Open All

General Information
Symbol	dsRNA-JF03115	Species	D. melanogaster
Feature type	RNAi_reagent	FlyBase ID	FBsf0000095804
Collection	TRiP-1	Associated gene(s)	Mef2
Genomic Location
	No sequence matches are recorded
Recent Updates
Description	What does this section display? This section contains items that were added to this record for each release. It currently only tracks new links between this FlyBase report and other FlyBase data classes (e.g. genes, references, stocks) or controlled vocabulary terms (e.g. GO, anatomy terms). What does this section not display? This section does not currently display links that were removed or gene model changes.
Update Feed	Click the icon below to subscribe to this FlyBase record and receive updates automatically through your feed reader.
FB2013_03
FB2013_02
All updates	Click here to see a list of all updates to this record from FB2010_08 and on.
Sequence Data
Length	415
Comments	One copy of repeat shown. (Perkins et al., 2009)
Sequence	ACCTGGGGACAATTTATACGGAAACACAATTATATAAAATTATATACACA ACTATATACAAGTAGAACTTGCCGTTTTAACAAGCCGTCCACTTATAAAA CAAACAGAAGGGATTATATATAGACAACCTATATAAATATGCCCCACGTC TGCCACGCCAGGAAGAGCCACAGCAATTCGCAGGGCAGCAACTAACGGAG TTTCCCCGCCAGCTGCCGGAAATCCAGTAGCAAATCCAGCAAACCAGCGA CCCAGTCAGCAGGAATCAGCCAGCCGAGCCGAGCACAAGGACACCACCAT CTCCGTTTCCATCGCAGGAGGATAGGAAATCTGTTGCCATGGGCCGCAAA AAAATTCAAATATCACGCATCACCGATGAACGCAATCGGCAGGTGACCTT CAACAAGCGCAAGTT
Associated Information
Gene(s) (targeted or local)	Mef2
Allele(s)	Mef2^JF03115
Transcripts(s)
Polypeptide(s)
Construct	P{TRiP.JF03115}
Experimental Data
Progenitors
PCR template	cDNA (Perkins et al., 2009)
Primer 1	AGTCTAGACCTGGGGACAATTTATACGG (Perkins et al., 2009)
Primer 2	AAGAATTCAACTTGCGCTTGTTGAAGGT (Perkins et al., 2009)
Comments
Collection Information
Collection: TRiP-1
Symbol	TRiP-1
Source and Progenitors
Species of derivation	D. melanogaster
Strain of derivation

Vector or progenitor construct	pVALIUM10 (Perkins et al., 1.15.2009) P{CaryP} (Perkins et al., 1.15.2009)
Description
	Collection of stocks carrying UAS-RNAi transgenes, each designed to target a single protein-coding gene; use a targeted insertion site. (Perkins et al., 1.15.2009)
Additional data
	The approach used by the TRiP is to generate transgenic animals with an RNAi hairpin under UAS-GAL4 control. The hairpin-containing transgenes are inserted via site-specific recombination into genomic loci known to be optimal for expression. This specific collection was constructed in the pVALIUM10 vector and inserted into the P{CaryP}attP2 target element. (Perkins et al., 1.15.2009)
Cell lines
Observed in
Not observed in
Comments

Stocks Listed in FlyBase ( 1 )
Bloomington	28699 y¹ v¹; P{TRiP.JF03115}attP2
External Crossreferences & Linkouts

Synonyms & Secondary IDs ( 2 )
Reported As
Symbol Synonym	dsRNA-JF03115 JF03115 (Perkins et al., 2009)
Secondary FlyBase IDs

References ( 1 )
Personal communication to FlyBase	Perkins et al., 2009, Update to TRiP stock collection. Update to TRiP stock collection. [FBrf0208864]