Open Close
General Information
Symbol
Dmel\GMR13F02
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000161930
Collection
Associated gene
Genomic Location
Chromosome (arm)
X
Sequence location

X:3,212,639..3,216,491

Sequence Data
Length
Comments
Associated Information
Experimental Data
Progenitors
PCR template
Primer 1
ggcgctgttctccaactcggtattt
Primer 2
cacagttgaagacccctccctttcc
Comments
Collection Information
Comments

evidence: Reporter construct (in vivo)

Stocks (1)
External Crossreferences and Linkouts ( 1 )
Crossreferences
REDfly - A database of transcriptional regulatory elements
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
Secondary FlyBase IDs
    References (6)