Open Close
General Information
Symbol
Dmel\GMR17H01
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000162315
Collection
Associated gene
Genomic Location
Chromosome (arm)
3R
Sequence location

3R:25,670,132..25,671,057

Sequence Data
Length
Comments
Associated Information
Experimental Data
Progenitors
PCR template
Primer 1
ccgaaaatcccgacgctctacgaag
Primer 2
ctactgcctcagcaacaatgtaacc
Comments
Collection Information
Comments

evidence: Reporter construct (in vivo)

Stocks (1)
External Crossreferences and Linkouts ( 1 )
Crossreferences
REDfly - A database of transcriptional regulatory elements
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
GMR17H01
Secondary FlyBase IDs
    References (5)