Open Close
General Information
Symbol
Dmel\GMR20F11
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000162565
Collection
Associated gene
Genomic Location
Chromosome (arm)
2L
Sequence location

2L:20,038,561..20,041,869

Sequence Data
Length
Comments
Associated Information
Gene(s) (targeted or local)
Transcripts(s)
    Polypeptide(s)
      Experimental Data
      Progenitors
      PCR template
      Primer 1
      atgagtacagagcgccccgggcata
      
      Primer 2
      cgtcctgaaattacgcaaagcgttt
      
      Comments
      Collection Information
      Collection: GMR_Brain_exp_1
      Title
      A set of GAL4 transgenes designed to be expressed in neuronal tissues.
      Source and Progenitors
      Species of derivation
      D. melanogaster
      Strain of derivation
      Vector of progenitor construct
      Description

      Collection of stocks carrying GAL4 transgenes fused to defined putative enhancer fragments from selected D. melanogaster genes; a targeted insertion site is used. The goal is to establish a collection of enhancers driving expression in small subsets of cells in adult brain.

      Additional data
      Sample preparation
      Collection preparation

      925 genes for which available expression data or predicted function implied expression in a subset of cells in the adult brain were selected. Spanning the flanking upstream and downstream intergenic regions of these genes, as well as any of their introns larger than 300 bp, regions were selected for testing that averaged 3 kb in length and overlapped (in regions that could not be covered by a single fragment) by approximately 1 kb. The fragment of genomic DNA to be tested for enhancer activity was generated by PCR, cloned into a Gateway donor vector, and verified by DNA sequencing. Site-specific recombination was used to transfer the fragment into the integration vector pBPGUw or pBPGw. Constructs in pBPGUw use a Drosophila synthetic core promoter (DSCP). Constructs in pBPGw use the putative endogenous promoter of the selected gene. Constructs were inserted into the P{CaryP}attP2 target element by phiC31 site-specific integration. Expression of GAL4 was detected either directly by in situ hybridization to the GAL4 mRNA or by assaying expression of a UAS-GFP fusion gene.

      Mode of assay
      Data analysis
      Cell lines
      Observed in
      Not observed in
      Comments
      Stocks (1)
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      GMR20F11
      Secondary FlyBase IDs
        References (3)