Home
Sequence Feature: region
| General Information | |||
|---|---|---|---|
| Symbol | GMR9D04 | Species | D. melanogaster |
| Feature type | region | FlyBase ID | FBsf0000168702 |
| Collection | GMR_Brain_exp_1 | Associated gene(s) | erm |
| Genomic Location | |||
| Chromosome (arm) | 2L | Sequence location | 2L:1,946,644..1,950,452 |
Map ( GBrowse )
 |
|
||
Recent Updates
|
|||
| Description |
What does this section display?
This section contains items that were added to this record for each release.
It currently only tracks new links between this FlyBase report and other
FlyBase data classes (e.g. genes, references, stocks) or controlled
vocabulary terms (e.g. GO, anatomy terms).
What does this section not display?
This section does not currently display links that were removed or gene model changes.
|
||
| Update Feed |
Click the icon below to subscribe to this FlyBase record and receive updates automatically through your
feed reader.
|
||
| FB2013_03 | |||
| FB2013_02 | |||
| All updates | Click here to see a list of all updates to this record from FB2010_08 and on. | ||
Sequence Data
|
|||
| Length | |||
| Comments | |||
| Sequence | |||
|
Associated Information
|
|||
| Gene(s) (targeted or local) |
|||
| Allele(s) |
|
||
| Transcripts(s) |
|
||
| Polypeptide(s) |
|
||
| Construct | |||
|
Experimental Data
|
|||
|
Progenitors
|
|||
| PCR template |
genomic DNA
|
||
| Primer 1 |
cacctggggtctgtcaaccgat
|
||
| Primer 2 |
ttcccgaaaaacaaggca
|
||
| Comments | |||
|
Collection Information
|
|||
|
Collection: GMR_Brain_exp_1
|
|||
| Symbol | GMR_Brain_exp_1 | ||
| Source and Progenitors | |||
| Species of derivation | D. melanogaster | ||
| Strain of derivation | |||
| Vector or progenitor construct | |||
| Description | |||
|
Collection of stocks carrying GAL4 transgenes fused to defined putative enhancer fragments from selected D. melanogaster genes;
a targeted insertion site is used. The goal is to establish a collection of enhancers driving expression in small subsets
of cells in adult brain.
|
|||
| Additional data | |||
|
The fragment of genomic DNA to be tested for enhancer activity was generated by PCR, cloned into a Gateway donor vector, and
verified by DNA sequencing. Site-specific recombination was used to transfer the fragment into the integration vector pBPGUw or pBPGw. Constructs in pBPGUw use a Drosophila synthetic core promoter (DSCP). Constructs in pBPGw use the putative endogenous promoter of the selected gene. Constructs were inserted into the P{CaryP}attP2 target element by phiC31 site-specific integration.
|
|||
| Cell lines | |||
| Observed in | |||
| Not observed in | |||
|
Comments
|
|||
|
Stocks Listed in FlyBase
( 0 )
|
|||
|
External Crossreferences & Linkouts
|
|||
|
Synonyms & Secondary IDs
( 1 )
|
|||
| Reported As | |||
| Symbol Synonym |
GMR9D04
|
||
| Secondary FlyBase IDs | |||
|
|
|||
|
References
( 2 )
|
|||
| Personal communication to FlyBase |
|
||