Sequence Feature: RNAi_reagent
| General Information | |||
|---|---|---|---|
| Symbol | dsRNA-HMS00889 | Species | D. melanogaster |
| Feature type | RNAi_reagent | FlyBase ID | FBsf0000169235 |
| Collection | TRiP-3 | Associated gene(s) | CHIP |
| Genomic Location | |||
| Chromosome (arm) | 2L | Sequence location | 2L:10,437,933..10,437,953 [+] |
Map ( GBrowse )
![]() |
|
||
Recent Updates
|
|||
| Description |
What does this section display?
This section contains items that were added to this record for each release.
It currently only tracks new links between this FlyBase report and other
FlyBase data classes (e.g. genes, references, stocks) or controlled
vocabulary terms (e.g. GO, anatomy terms).
What does this section not display?
This section does not currently display links that were removed or gene model changes.
|
||
| Update Feed |
Click the icon below to subscribe to this FlyBase record and receive updates automatically through your
feed reader.
|
||
| FB2013_03 | |||
| FB2013_02 | |||
| All updates | Click here to see a list of all updates to this record from FB2010_08 and on. | ||
Sequence Data
|
|||
| Length | 21 | ||
| Comments |
One copy of repeat shown.
A top strand oligo is designed by concatenating "ctagcagt", the sense-strand oligo, "tagttatattcaagcata", the anti-sense oligo,
and "gcg". A bottom strand oligo is designed by concatenating "aattcgc", the sense-strand oligo,"tatgcttgaatataacta", the
anti-sense oligo, and "actg".
|
||
| Sequence | ACGCAATAAATTGCTACTCAA |
||
Associated Information
|
|||
| Gene(s) (targeted or local) |
|||
| Allele(s) | |||
| Transcripts(s) |
|
||
| Polypeptide(s) |
|
||
| Construct | |||
Experimental Data
|
|||
Progenitors
|
|||
| PCR template |
genomic
|
||
| Primer 1 | |||
| Primer 2 | |||
| Comments | |||
Collection Information
|
|||
Collection: TRiP-3
|
|||
| Symbol | TRiP-3 | ||
| Source and Progenitors | |||
| Species of derivation | D. melanogaster | ||
| Strain of derivation | |||
| Vector or progenitor construct | |||
| Description | |||
|
Collection of stocks carrying UAS-RNAi transgenes, each designed to target a single protein-coding gene; inserted into the
genome using a phiC31\attP integration site.
|
|||
| Additional data | |||
|
The approach used by the TRiP is to generate transgenic animals with an RNAi hairpin under UAS-GAL4 control. The hairpin-containing
transgenes are inserted via site-specific recombination into genomic loci known to be optimal for expression. This specific
collection was constructed in the pVALIUM20 vector and inserted into the P{CaryP}attP2 or P{CaryP}attP40 target element.
|
|||
| Cell lines | |||
| Observed in | |||
| Not observed in | |||
Comments
|
|||
Stocks Listed in FlyBase
( 1 )
|
|||
| Bloomington | |||
External Crossreferences & Linkouts
|
|||
Synonyms & Secondary IDs
( 2 )
|
|||
| Reported As | |||
| Symbol Synonym |
dsRNA-HMS00889
HMS00889
|
||
| Secondary FlyBase IDs | |||
|
|
|||
References
( 1 )
|
|||
| Personal communication to FlyBase |
|
||

Recent Updates
Sequence Data