Open Close
General Information
Symbol
Dmel\dsRNA-GLV21071
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000382966
Collection
Associated gene
Genomic Location
Chromosome (arm)
2L
Sequence location

2L:5,993,264..5,993,284 [-]

Sequence Data
Length
21
Comments

A top strand oligo is designed by concatenating "ctagcagt", the sense-strand oligo, "tagttatattcaagcata", the anti-sense oligo, and "gcg". A bottom strand oligo is designed by concatenating "aattcgc", the sense-strand oligo,"tatgcttgaatataacta", the anti-sense oligo, and "actg".

One copy of repeat shown.

TAGAGTTGTTCGTTCAAGAAA
Associated Information
Gene(s) (targeted or local)
Allele(s)
Transcripts(s)
    Polypeptide(s)
      Construct
      Experimental Data
      Progenitors
      PCR template
      Primer 1
      Primer 2
      Comments
      Collection Information
      Collection: TRiP-5
      Symbol
      Title
      A set of transgenic RNAi constructs for expression of shRNA under UAS control, TRiP second generation (pVALIUM21).
      Source and Progenitors
      Species of derivation
      D. melanogaster
      Strain of derivation
      Vector of progenitor construct
      Description

      NOTE: Dataset members correspond to the amplicon sequence features; these can be used to retrieve associated constructs and stocks.

      The TRiP-5 construct collection represents a second generation of TRiP lines. Each construct is designed to target the knockdown of a single gene during oogenesis using short hairpin RNA (shRNA).

      Additional data
      Sample preparation
      Collection preparation

      Transgenic animals were designed to carry a short hairpin (shRNA) microRNA under UAS-GAL4 control. These shRNA are inserted into pVALIUM21, which is a variant of pVALIUM22 (TRiP-4) that lacks the ftz intron and gypsy sequences.

      Mode of assay
      Data analysis
      Cell lines
      Observed in
      Not observed in
      Comments
      Stocks (1)
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      dsRNA-GLV21071
      Secondary FlyBase IDs
        References (1)