Sequence Feature: RNAi_reagent
| General Information | |||
|---|---|---|---|
| Symbol | HFA10546 | Species | D. melanogaster |
| Feature type | RNAi_reagent | FlyBase ID | FBsf0000391412 |
| Collection | HFA | Associated gene(s) | Fhos |
| Genomic Location | |||
| Chromosome (arm) | 3L | Sequence location | 3L:8,770,239..8,770,415 [+] |
Map ( GBrowse )
![]() |
|
||
Recent Updates
|
|||
| Description |
What does this section display?
This section contains items that were added to this record for each release.
It currently only tracks new links between this FlyBase report and other
FlyBase data classes (e.g. genes, references, stocks) or controlled
vocabulary terms (e.g. GO, anatomy terms).
What does this section not display?
This section does not currently display links that were removed or gene model changes.
|
||
| Update Feed |
Click the icon below to subscribe to this FlyBase record and receive updates automatically through your
feed reader.
|
||
| FB2013_03 | |||
| FB2013_02 | |||
| All updates | Click here to see a list of all updates to this record from FB2010_08 and on. | ||
Sequence Data
|
|||
| Length | 177 | ||
| Comments | |||
| Sequence | AAATGGAGCCGGACGAACTGATCACATTCCGTGTCCAGTATCTGGTGGAC AGCGATCCGCTCTCGGCGTGCACCGCCTTCCCGATCCCGGTGCGGGCGCC CACCTACGCCTTCGCCACCACCATGCCGCTGGCCAATCAGCTGGGCACAA TCCTGCGGCTGCTGAATGCACCACAAA |
||
Associated Information
|
|||
| Gene(s) (targeted or local) |
|||
| Allele(s) |
|
||
| Transcripts(s) |
|
||
| Polypeptide(s) |
|
||
| Construct |
|
||
Experimental Data
|
|||
Progenitors
|
|||
| PCR template |
genomic
|
||
| Primer 1 |
AAATGGAGCCGGACGAAC
|
||
| Primer 2 |
TTTGTGGTGCATTCAGCAG
|
||
| Comments | |||
Collection Information
|
|||
Collection: HFAHFA
|
|||
| Symbol | HFAHFA | ||
| Source and Progenitors | |||
| Species of derivation | D. melanogaster | ||
| Strain of derivation | |||
| Vector or progenitor construct | |||
| Description | |||
|
Collection of double-strand RNA fragments, used for genome-wide RNAi-knockdown assays in cell culture. RNAi targeting of transcripts
annotated by the Berkeley Drosophila Genome Project and additionally predicted gene models.
|
|||
| Additional data | |||
| Cell lines | |||
| Observed in | |||
| Not observed in | |||
Comments
|
|||
Stocks Listed in FlyBase
( 0 )
|
|||
External Crossreferences & Linkouts
|
|||
|
GenomeRNAi
- GenomeRNAi – A database for cell-based and in vivo RNAi phenotypes and reagents
•
|
|||
Synonyms & Secondary IDs
( 1 )
|
|||
| Reported As | |||
| Symbol Synonym |
HFA10546
|
||
| Secondary FlyBase IDs | |||
|
|
|||
References
( 1 )
|
|||
| Personal communication to FlyBase |
|
||

Recent Updates
Sequence Data