Open Close
General Information
Symbol
Dmel\HFA16272
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000395352
Collection
Associated gene
Genomic Location
Chromosome (arm)
3R
Sequence location

3R:17,625,336..17,625,918 [+]

Sequence Data
Length
583
Comments
GCTTCAGGAAACCCAAAGAGCGGAGCGGCAACCGCCCAATGCGGAGTAAGGGTCGGTGATGATCTTGCCAATGCTCGAGC
CGGAGTATTCGCCTCCACTCCAGGCGCTGGGGGTCCGGTCACCAAGGGAGTTTATGGAGCGGTCAACGCGTAAGTCCAGT
AAAAGTTCTTAAAAATGCTAAAATAAATATTATAATTTTGTAAACTTTCTTCTCTTCATCCCACAGCAATGGTCATGCAC
TCTCACTGCAGCATGGCCACATCGAGGGCGTGGGCAGCACTACCACTGCCGCAGCCCAAGCCAATCTCTTCCAGAGCAAT
AACGCCGCTCTGAATGCCACTGCATTTCACAGTCATAGCCGATCGCACGATCAGTTTGGCGGAGGACTCAATTTGCAAAC
TGGAACGGGTCACCAGGCGGCAGTGGGGGTCACTAGGGTTCCTCAGTTCGGCATGACCGCCGTCCAGGCTTCTGGCACAG
CAAATCTGTATACCTCTCCAAGTGGCAATCTCAACCTCAACGCCACCGGAAGTGCCAATCATCACCTCAGGGGACCGATG
CGCGGCAAGTCCGATTTCGGCAC
Associated Information
Gene(s) (targeted or local)
Allele(s)
    Transcripts(s)
      Polypeptide(s)
        Construct
          Experimental Data
          Progenitors
          PCR template
          Primer 1
          GCTTCAGGAAACCCAAAGAG
          
          Primer 2
          GTGCCGAAATCGGACTTG
          
          Comments
          Collection Information
          Collection: HFA_dsRNA
          Symbol
          Title
          GenomeRNAi HFA collection of dsRNA for RNAi in cell culture.
          Source and Progenitors
          Species of derivation
          D. melanogaster
          Strain of derivation
          Vector of progenitor construct
          Description

          Collection of double-strand RNA fragments, used for genome-wide RNAi-knockdown assays in cell culture. RNAi targeting of transcripts annotated by the Berkeley Drosophila Genome Project and additionally predicted gene models.

          Additional data
          Sample preparation
          Collection preparation
          Mode of assay
          Data analysis
          Cell lines
          Observed in
          Not observed in
          Comments
          Stocks (0)
          External Crossreferences and Linkouts ( 0 )
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          Secondary FlyBase IDs
            References (1)