Open Close
General Information
Symbol
Dmel\dsRNA-1569R
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000430534
Collection
Associated gene
Genomic Location
Chromosome (arm)
3R
Sequence location

3R:31,581,083..31,581,118 [+]

3R:31,581,181..31,581,518 [+]

3R:31,581,608..31,581,733 [+]

Genomic Maps

Multiple sequence regions exist. Please click on a sequence location for a GBrowse view of the region.

3R:31,581,083..31,581,118 [+]

3R:31,581,181..31,581,518 [+]

3R:31,581,608..31,581,733 [+]

Sequence Data
Length
500
Comments
TCGCGAGGCATCTTCCAAATAAGCAGTGAAGAGGAAGTAAACAAATATCCAGATGTCATGGCCTCCGTGCAGTGCGGCAA
GATGGTCATTGGCATCGACAAGAGCCTTTTGCTCCTGGAGGACGAACTGGTGGCCAAGTGCAGCTTTCTGGCATTCGGGG
CAGCCATTGAGGCCATTGCCATTTCTTCAAGCGGCAACCTGATTGTATGCGGCCTCAGCGATGGCGAAGTTCACGGAGTG
TTCATCAAGGGCCTGCTCCTGTTCAGCGTGGCCGTCAATCTGGAGGACGTGAGCCTAACTGGCGGGACCTTCCGGAGCAT
CCATCAACTGGATCAGCGGTTTTACTTCACCTGTAAGAATGGAAGCATCTATAGCTTAAGCGACATTGATGAGACCTGCT
TGGAAACGTTAGGCAATATGAGCCTGAATGAAAACGAAACTATAGCTTGCGAAAAGGCCCTGCTCGAGGACGTCACCATT
CAACGTCTTTCCAAGGGCAG
Associated Information
Gene(s) (targeted or local)
Allele(s)
Transcripts(s)
    Polypeptide(s)
      Construct
      Experimental Data
      Progenitors
      Primer 1
      aaggcctacatggccggaccgTCGCGAGGCATCTTCCAAATA
      
      Primer 2
      aatctagaggtaccCTGCCCTTGGAAAGACGTTGA
      
      Comments
      Collection Information
      Collection: NIG_RNAi_Fly-1
      Title
      A set of transgenic RNAi constructs for expression of dsRNA under UAS control, NIG-FLY.
      Source and Progenitors
      Species of derivation
      D. melanogaster
      Strain of derivation
      Vector of progenitor construct
      Description

      Comprehensive collection of stocks carrying UAS-RNAi transgenes, each designed to target a single protein-coding gene.

      NOTE: Dataset members correspond to the amplicon sequence features; these can be used to retrieve associated constructs and stocks.

      Additional data
      Sample preparation
      Collection preparation

      A collection of over 6,400 RNAi transgenes (over 12,300 lines), each designed to target a single protein-coding gene. Each construct contains a pair of identical 500-bp amplicons produced using cDNA templates. These have been cloned as inverted repeats that are expressed using the binary GAL4/UAS system, producing transcripts capable of assuming a double-stranded RNA structure.

      Mode of assay
      Data analysis
      Cell lines
      Observed in
      Not observed in
      Comments
      Stocks (0)
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (1)