Open Close
General Information
Symbol
Dmel\y_D-2873
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000435555
Collection
Associated gene
Genomic Location
Chromosome (arm)
X
Sequence location

X:353,638..361,329 [+]

Sequence Data
Length
7692
Comments
GTCGACTATTAAATGATTATCGCCCGATTACCACATTGAGTGGTTTAAAATAGCCATAAAATATGCAACTGACGATGGCT
TAAGATAAATACGTCGCAGAGTCACTCATAAATTTCGAACGCAGCCCGCTGATTTACCTACCCCTCTAAACGATTCATAG
TATATGTACGAGTATATCCACTAAGCTTTTTCGAGCACTGATTTTTTCGCTTGCACGAGACAAGTGCACCACCGCAATTG
CAGGCAAATTATGTCTGAGGTAATGATTCCGTTTCGTGCAAGATTACACAGAAATCAAATTACGACAACCTTTATTCAGT
AAGCAAACAAAGCCTTTGTTGGCATCTAATTATTCCACTTATGGTTGCGATTTCGGGAGCTACAATCGGTTTTGGTTTAG
TATATCTAGCGAGTTCCTTGGCGACATTTAAAATTTACAAATAAAGTTTCTCTATTCAATCGGGACAGTGGAAATTGACT
ATTTTATTTATATTAATGAACTTATTTTTAATTTGGCTTAAGTTACTAAGGGGTACTAATAGTTTGAGCGCAGTGCATGT
CATGGGGACATGTGCAATTGTGTGTAAGCGGGAAGTGATCGCGGCCTTCCGAATTTGGCCATGCCAAATAATCCCAGCTC
GAAAGGAGGGGACCCGGCGGTCAGGGCCATGGACATTGAACTTGAAAAAAAAAAAAACACAAAAATATATAACACAAAAC
GGAAAATGCTGTGTACCGCTTATGTTAGAGAAGTTGAGCAACGGGTTTTTCGTTTTGCAGTCACGATGGATTTCCAAATT
AGTGTAGGAGGGGGGAGGGGAGGGAGGGAGATAATGTCCAGGCTGCCATAAGTGGGGAATAAGGAAAATAAAACATGAAA
CACGGGTCGGGCAATGTCATGCGGTATTCGGCTTTGCTTTCCGCCCAAGTTGAAGTGATCCTGTGTGTAAATAATGTCGA
ATGTTGCCGGTCGGTTGCATAAGCGTTAGTCAATTATGCCAAAGAGATCTGATTTGTGGAAGCTTTTTTTGACCACTTAG
CGCGCTCCGCTTGATGTTGTTTTGTTTTGTGCTGGGGCAGAAAACTTGTTTCAATTATTGGGAAAAGTGCGTATAAATCA
TTGCCGCAAGCTCTGAAAAGCGAAAAAGAAAAACAGTAACCAAACAGACAAACGCAGCATCCCCCCACACAATTAAGCAA
AAACTTGAAAACAAGTCAATTCGAAAAAAATTATAGGTTCAACGGCTGCAGCGATCGCATCATTAGTTGCGTTTTTAGTA
AATACACCATTTCATTACACAACACACACAATTAATTAATAAAACTGTACTGGTTATTTCAAGTGTGTCTTTTAATAAGC
CTGCCGATCGCAATAAATTCGAGCAGCATTGCCGGTAATTTTGTGCAACATATTTTTCGATTGCCACACCGTGTTTGTTT
ATTTTTCTGTGGGTGCAATGATTTAGAATGCGGGCAAGGGATCAAGTTGAACCACTTCTAAGAAAAAATAGCATTGCATA
AATGATATAGAGTCCAAAAACTACACAAATTCAATAGCAGTAATGGTTACATTAGCTTTGAAATTGTTTTTAGACATCCG
AAGAAATAAGATTAAATTTAAACGGCATTCTTTAATTTGTATTTTAATATTTTGAGAGGTTTTCCTTATTTAAAGTGTAG
ATTATTGAGGATTAATGCAAACCACTTTATCTGCGGAGGTCGTAAAACGTATTTTTACCCATTTGCATGTTTATTATGCG
TGTGGCTGGTTGTATTACTTTACTTAAGTTTTGCAATTTTTTCTTTAGCAAGCAGGTGCATTTGGGCCAAGAGATATATG
CGATCGCTTTCGGTTCGAATTTTTAACATTTACTTGCGGCGATGGTCATTAGAGCATTACCCACTTAGGGCACCCCCAAC
ATCCAGTTGATTTTCAGGGACCACAATATTTTAAATAACAGCTAGTGGAATTACCTAAAAGCGCTTTCGTCCCTTTTGAA
ATTTTATGTAACACTCAATTATATTTATGTATATGTATGCTCAAAATCACCTGCCAATAACTAGCGGAAACCAAATATTT
GACCCTCAGTGAATTGTGAATCATCGGTGACGCCCAATCGAAATCCAATCCTAAGCAATTGAAACGAGCACGAGTTCCAA
TTTAATAGTATACAAGGAAACACCTGCTTTAAATACTCTACATAGTACACGTTATAATAACGATTTATTTGATATTTCTG
GATTTTTGTCTGCATGTATTTCATATAATATTGATTTGATTTTTTTAATGAATTGAACTAAAAAATCATATTAGAACATT
TTTTGCAGTCGCCGATAAAGATGAACACTGTTCTCAGAACACAACTGTCATGTATTAAGCTTTCAGATTTTCAGAAATTT
GGAGAGCAATGCATTCTATGCACGAGCCTCCTGGCCTTACAATTTACTTGTTTGAAATTAGATCGTCAAATAAAGTCCCT
AAAATTAAATAAATAGTAGTCACAACTTTAAAATAGGTCTTAATCTTTTAGGGTACCGAAAGGTATTTCGGCACAAATCA
GCGCAGTTTTAAATGTCGATGAAGGCCAAAAATCATACCAAACCCAGCGAAAGGTGATGTCTGACTCATTAAATTGGGGG
ATTCGAGTGTATTTATTAAACATGCGTGAAAATCAATCATGGAAGACAAAACGCAAAGTTGGCCGATCTATGGGAACAGC
ATAAGCCACCTGATTACCCGAACACTGAACCACCCGAATCACTAAAACCACCGAAGTTGGCGCGCGCCTTCGTTTTCATT
TTCATTGGCCTGTCTTCGTCTTCGGAGAAAAAAAACTTCATATAAAACGCGGCCGACATATTATGGCCACCAGTCGTTAC
CGCGCCACGGTCCACAGAAGAGGATTAAAAAAATATCACACAGCCGAAGGCTAGAGAAGAACCCCCTATAGCTGAACATA
TATAAACAAATATATTTTTTTTTATTGCCAACACACTTTGGCTTAAGTGTTAAGAGTGATTGTCAGCTTAGAGCTAAGTG
CACTGTTCCAGGACAAAGGGTGGATCCTTGTGACCCTGATCACCTTGGTGACGCCGTCTTGGGCTGCTTACAAACTTCAG
GAGCGATATAGTTGGAGCCAGCTGGACTTTGCTTTCCCGAATACCCGACTAAAGGACCAAGCTCTGGCTAGTGGAGATTA
TATTCCGCAAAATGCTCTACCTGTTGGAGTCGAACACTTTGGCAATCGGTTATTCGTCACTGTTCCCCGCTGGCGTGATG
GTAAGTGGAAGTTAAATATGAAGCCCTTGGGGAGATCGTAAATGGGACATTCTTACTTAGGGCATCAGAGATATCTGATT
GAGTGGTTGACAGTTTTATATGGCTTGTTTGACATGATGTAAAAACACAAAATTCATTTAGTTTAGGTATTCAAATAAGA
GCTTGTTATTTATTTTAGAATTTGGAGAACATTTTTTTGTCTTTCTACCCTTCTTAGAAAATAATATTGTTTTGTACAAT
TTAATTTTAAACTAGTACAGACGAAAAATGTATTTTTTTATTTGTATGCCTTTTCACCATTTTGGCAGAGGAATAAATAT
GACAATATATTTTGAGAGCACCCTCATGTAAAGGTTTTAGCGTGGCGACCTCTCATAAATCCGGTTGGTACCTGCGCGTT
ATTTTAACATTTTAAACAATTAACCGTTGTAAAATCGAAGCCAATAGCATGGCATTGGCTTTATACTGTATTAAATTGTA
TTATATTACCATCCGAATTGTAAAGACTTCTTCAGGGCCGCCACATAGAAATGGAAATCCAATCACAAACAATAACTTAT
GGCATTAGCTATTAACCGACGATTAGCTGTCAGTTCAACAAATGTAAGAGTGGCGAAATGTTTAAATGCGAAGGCATTGT
TCTGTGACTCACGTTTTATTATTAATCACACAAATGATTTTGCTTCAAAATTATTTGGCTTACACAATAATCAAAATTTT
TATGAAATAGTTGAAACACAAAACTAGGAAATTTTAAAAAGCAATGAAACTAAAAAACCCAATTGCTAAGATTATATGAT
GCGCATACAAATACTTCAGTACGTCTAGGAATGCTTTCGATGATTGATTAGTTTTTATGCATGGCTTACAATTGGTATTT
ACACAGAAAAACACGGCGATGTTAATAAATTTTGTACATATGTTCTTAAGCAGTCCGAAACACCCAAACTTCTGACTAAA
CTTAAAAAAACACGCTCTTCAAGGATATCTTAATGTCACTTATAATGTAATGGTATTGTATTATTAAGTATATCAAAATA
TTCTGGCCCAGCCTTGAGGTCTCTTTTTAAAAAGATATCGACTGACTACCTCCAGTCAATGAAATAATAGCCCAGAAGGC
CGAATCGGCAAAAAATAAACCCCAAGTTACGGCAAACAAAACATAGTGAAAGTTGTGGCAAAGTGGAACATTTAAAGGCA
TGCTTCAATGGCCATCGAAGCAAATCAATTAGTCAAAGCAAATCGGTAGTGGCAACAACAGGCTACAGAATACCTATAAG
TGACAGTTATGGGGTATGATTAATTATAAATATTATCATTGACCACCAATGCTGGGCTCAATTGGAAAAACTATTCTATG
AAGATTTGAGTAAATAAATTTTGATTTAAAAAAGCCCATGGTTATCGCGACAACTAGCTACGGGACAAGATTACTGTTTA
AAATCAAGTGTGAAATATCAAAATCAAAATCGGATTCCGATCGGGAAGTTGTATCCGATTCTGAAACTAAAACACAGAAT
TGCCAACATTTTCCGATATCGACTCAGCTCACGTATTTCATACAGATTCATTAGGCCACCAGCCATTGAATAATATACCC
CAGTCAATTGAGCTACTCGATAGTTGATCAACTTAGCTTTTGTCAACGAGTGAACGCATAAACTACTACATCAACGATAT
TTGCGGCCCATTCCAAGCTAAAAGTTCATCTTAATTACAAATAAGATTAGAAAAAATATCTGAATGAAAAAAATGTTGAG
ACATATTTCTTTGGAAAAGGAGAACCTCAAGACAGTCGAAAAAATTGTTTACAATGAAAATGTTGAAAATCATGAAGCAG
ATAAATCTGTCAGTTGCGAGGTTTTAGGACTGAAAGAGCACATGTCAAAATATAAATTTGTTCAAATACTTTATATTTGA
CTGAATTAGATTGTTATTTTAAAAGTTATGAATTAAATAAAGATTGAAAGGTGCATTATGCTCAAATGTATATTTATCGC
AACCCCCGGTTACTTTGTAAAGCAAAAACGCCTGGTTTGATTTTTAAGAAGATGGGTCGGTAAATCGATAAAAGCTATAT
TTTCTGGTCGTTGCAGTCTCACTCGCCTGCTATAAAAACATTAAAAGTTCCCAGAAACAATAAATGTCTTTAAATTCAAT
TAACGAAGAAATAAAGAAGGAAAAGAACTGGAGCGGAAATCGGTCGAAATACTGCCAATGGCCACATATACATTTAACAG
CGATATATGGTATACATATTGATAATGATGTCAGACGCAATTGCTTCAGACGGCTAATGACATCGCAAATTGCACGCAAC
TTGCAATAGTGCCAATTATGACTGAAGTACATATAGCCGGGGATCTTTTAACATAAACTTCCAGTAGATGTACAAGCAGA
AAAAAGAGCCATTAGCACGGCAGTTACCATTGCTTATGATTCCTTGTGTCCAAAATAATGACAAATAGGTATATAAATAA
TTAAATGCCAAACATAAGCGATTCTAATTTACCTTTACATCTGTATGCATTTACATATTATCCAGAAAACAGACAGCGAT
AACTTGCAACATTGCTTAGTATAATAATCCAAAGAAGGAATTTAGGCAGAAATTCCAGTTAATTAAATATTCAAAACAAA
CTTTATTTAGTGCCTCAATAATAGTTTGGCCCTGCTAATTCTCCTATTTTATTTTTTAGGGATTCCGGCCACTCTGACCT
ATATAAACATGGACCGCAGTTTGACGGGTTCACCGGAGCTAATTCCGTATCCAGATTGGCGCTCAAATACAGCTGGAGAT
TGCGCCAACAGTATTACCACTGCCTACCGCATTAAAGTGGATGAGTGTGGTCGGCTGTGGGTTTTGGACACTGGAACCGT
GGGCATCGGCAATACCACCACTAATCCGTGCCCCTATGCGGTAAATGTCTTTGACTTGACCACGGATACGCGAATTCGGA
GATACGAGCTACCTGGCGTGGACACAAATCCAAATACTTTCATAGCTAACATTGCCGTGGATATAGGCAAAAATTGCGAT
GATGCATATGCCTATTTTGCCGATGAATTGGGATACGGCTTGATTGCTTACTCCTGGGAACTGAACAAGTCCTGGAGATT
CTCGGCACATTCGTATTTTTTCCCCGATCCATTGAGGGGCGATTTCAATGTCGCTGGTATTAACTTCCAATGGGGCGAGG
AGGGTATATTTGGTATGTCCCTTTCGCCCATTCGATCGGATGGTTATCGTACCCTGTACTTTAGTCCGTTAGCAAGTCAT
CGACAATTTGCCGTATCCACGAGGATTTTGAGGGATGAAACCAGGACGGAAGATAGCTATCATGACTTTGTTGCCTTAGA
TGAACGGGGTCCAAACTCCCATACCACTTCACGTGTGATGAGCGATGATGGAATTGAGCTGTTCAATTTAATAGATCAAA
ATGCAGTGGGTTGCTGGCACTCATCAATGCCGTACTCACCGCAATTTCATGGCATTGTGGATCGCGATGACGTTGGCTTA
GTTTTTCCGGCCGATGTGAAAATTGATGAGAACAAAAACGTTTGGGTTCTATCCGATAGGATGCCCGTTTTCTTGCTGTC
TGACTTGGATTATTCAGATACTAATTTCCGAATTTACACGGCTCCCTTGGCCACTTTAATTGAGAATACTGTGTGTGATT
TGAGGAATAACGCCTATGGGCCGCCAAATACCGTTTCAATACCAAAACAAGCCGTTTTGCCAATGGGTCCACCGTTATAT
ACGAAACAATATCGTCCTGTCTTGCCACAGAAACCTCAGACCAGCTGGGCTTCCTCGCCGCCTCCTCCAAGTCGCACTTA
TTTGCCCGCCAATTCAGGCAATGTAGTCTCCAGTATTAGTGTCTCTACAAATTCTGTGGGTCCTGCAGGAGTGGAGGTGC
CAAAGGCCTATATTTTCAACCAGCACAACGGCATAAATTACGAGACAAGTGGTCCCCATCTATTTCCCACCCATCAACCC
GCCCAACCGGGTGGCCAGGATGGTGGGTTAAAAACTTATGTGAATGCCCGCCAATCTGGGTGGTGGCATCATCAGCATCA
AGGTTAACATAATCCTACACACGGTACTTGGGTATATTCTCACACACTCGATTGATGTAAAGAATATTTAAAGACAACAA
CATAGGGCAACAGCGGTTAAAAAAACCACATGACGTATGAGCAAGTGGCAAATCAATACTTTATCTAGTTATGTTAAGCA
AAAAATAACAATAAATCAACTTTTTTTTGAAGGTTAAGAGTTTACGCAATTTTCTTGAGCGGAAAAAGCGGAAAAAATGT
AAGTATGCATAAATTCTAAATATATCAACAACTGTACATTTTCTGGAGTACTACTACCAGGCAAGAAAGTAGGTTGATAA
AGCTATGCACAA
Associated Information
Gene(s) (targeted or local)
Allele(s)
Transcripts(s)
    Polypeptide(s)
      Construct
      Experimental Data
      Binding data
      Bound moiety
      Comments on moiety
      Mapped to restriction fragment
      Evidence or Assay

      Reporter construct (in vivo)

      Collection Information
      Collection: REDfly CRMs
      Symbol
      Title
      Source and Progenitors
      Species of derivation
      D. melanogaster
      Strain of derivation
      Vector of progenitor construct
      Description

      Experimentally validated, minimal functional cis-regulatory regions (CRMs) curated from the literature by REDfly (version 3.0).

      Additional data
      Sample preparation
      Collection preparation
      Mode of assay
      Data analysis
      Cell lines
      Observed in
      Not observed in
      Comments
      Stocks (1,401)
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      REDfly - A database of transcriptional regulatory elements
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (2)