A Database of Drosophila Genes & Genomes

FB2013_03, released May 7th, 2013
 

Sequence Feature: regulatory_region

General Information
Symbol lab_50bp3prime Species D. melanogaster
Feature type regulatory_region FlyBase ID FBsf0000435820
Collection REDfly CRMs   Associated gene(s) lab
Genomic Location
Chromosome (arm) 3R Sequence location 3R:2,507,221..2,507,269 [-]
Map ( GBrowse ) GBrowse View Help detailed view FBsf0000160450 FBsf0000160448 FBsf0000160449 FBsf0000163034 FBsf0000163134 FBsf0000436621 FBsf0000161237 FBsf0000436269 FBsf0000435625 FBsf0000435820 FBsf0000436838 FBsf0000436222 FBsf0000161236 FBsf0000161242 FBsf0000436262 FBsf0000435681 FBsf0000435511 FBsf0000435748 FBsf0000435761 FBsf0000161239 FBsf0000161238 FBsf0000435692 FBsf0000435980 FBsf0000161240 FBsf0000161235 FBsf0000247756 FBsf0000369033 FBsf0000309950
hide Recent Updates
Description
What does this section display?
This section contains items that were added to this record for each release. It currently only tracks new links between this FlyBase report and other FlyBase data classes (e.g. genes, references, stocks) or controlled vocabulary terms (e.g. GO, anatomy terms).
What does this section not display?
This section does not currently display links that were removed or gene model changes.
Update Feed
Click the icon below to subscribe to this FlyBase record and receive updates automatically through your feed reader.
FB2013_03
FB2013_02
All updates Click here to see a list of all updates to this record from FB2010_08 and on.
hide Sequence Data
Length 49
Comments
Sequence
CCATATATCTTACTTCCGACGCTTTCATGGCGCTAAACAGACGTTGATG
hide Associated Information
Gene(s)
(targeted or local)
Allele(s)
Transcripts(s)
Polypeptide(s)
Construct
hide Experimental Data
hide Progenitors
PCR template
Primer 1
Primer 2
Comments
hide Collection Information
hide Collection: REDfly CRMs
Symbol REDfly CRMs
Source and Progenitors
Species of derivation D. melanogaster  
Strain of derivation
Vector or progenitor construct
Description
Experimentally validated, minimal functional cis-regulatory regions (CRMs) curated from the literature by REDfly (version 3.0).
Additional data
Cell lines
Observed in
Not observed in
hide Comments
hide Stocks Listed in FlyBase ( 0 )
hide External Crossreferences & Linkouts
REDfly
hide Synonyms & Secondary IDs ( 1 )
Reported As
Symbol Synonym
lab_50bp3prime
 
Secondary FlyBase IDs
    hide References ( 2 )
    Research paper
    Marty et al., 2001, Development 128(14): 2833--2845
    A HOX complex, a repressor element and a 50 bp sequence confer regional specificity to a DPP-responsive enhancer. [FBrf0138363]
    Personal communication to FlyBase
    Halfon, 2012.6.19, REDfly CRMs and TFBS as mapped FlyBase features.
    REDfly CRMs and TFBS as mapped FlyBase features. [FBrf0218775]