Sequence Feature: RNAi_reagent

Help Close All Open All

General Information
Symbol	dsRNA-HMS02265	Species	D. melanogaster
Feature type	RNAi_reagent	FlyBase ID	FBsf0000437576
Collection	TRiP-3	Associated gene(s)	pHCl
Genomic Location
Chromosome (arm)	3L	Sequence location	3L:15,861,675..15,861,695 [-]
Map ( GBrowse )
Recent Updates
Description	What does this section display? This section contains items that were added to this record for each release. It currently only tracks new links between this FlyBase report and other FlyBase data classes (e.g. genes, references, stocks) or controlled vocabulary terms (e.g. GO, anatomy terms). What does this section not display? This section does not currently display links that were removed or gene model changes.
Update Feed	Click the icon below to subscribe to this FlyBase record and receive updates automatically through your feed reader.
FB2013_03
FB2013_02
All updates	Click here to see a list of all updates to this record from FB2010_08 and on.
Sequence Data
Length	21
Comments	One copy of repeat shown. (Ni et al., 2010.12.1) A top strand oligo is designed by concatenating "ctagcagt", the sense-strand oligo, "tagttatattcaagcata", the anti-sense oligo, and "gcg". A bottom strand oligo is designed by concatenating "aattcgc", the sense-strand oligo,"tatgcttgaatataacta", the anti-sense oligo, and "actg". (Ni et al., 2010.12.1)
Sequence	AAGCGCTACGATAAACGATTA
Associated Information
Gene(s) (targeted or local)	pHCl
Allele(s)	pHCl^HMS02265
Transcripts(s)
Polypeptide(s)
Construct	P{TRiP.HMS02265}
Experimental Data
Progenitors
PCR template	genomic (Ni et al., 2010.12.1)
Primer 1
Primer 2
Comments
Collection Information
Collection: TRiP-3
Symbol	TRiP-3
Source and Progenitors
Species of derivation	D. melanogaster
Strain of derivation

Vector or progenitor construct	pVALIUM20 (Ni et al., 2010.12.1) P{CaryP} (Ni et al., 2010.12.1)
Description
	Collection of stocks carrying UAS-RNAi transgenes, each designed to target a single protein-coding gene; inserted into the genome using a phiC31\attP integration site. (Ni et al., 2010.12.1)
Additional data
	The approach used by the TRiP is to generate transgenic animals with an RNAi hairpin under UAS-GAL4 control. The hairpin-containing transgenes are inserted via site-specific recombination into genomic loci known to be optimal for expression. This specific collection was constructed in the pVALIUM20 vector and inserted into the P{CaryP}attP2 or P{CaryP}attP40 target element. (Ni et al., 2010.12.1)
Cell lines
Observed in
Not observed in
Comments

Stocks Listed in FlyBase ( 1 )
Bloomington	41700 y¹ sc^* v¹; P{TRiP.HMS02265}attP40
External Crossreferences & Linkouts

Synonyms & Secondary IDs ( 2 )
Reported As
Symbol Synonym	dsRNA-HMS02265 HMS02265 (Ni et al., 2010.12.1)
Secondary FlyBase IDs

References ( 1 )
Personal communication to FlyBase	Ni et al., 2010.12.1, A genome-scale shRNA resource for transgenic RNAi in Drosophila. A genome-scale shRNA resource for transgenic RNAi in Drosophila. [FBrf0212437]