Open Close
General Information
Symbol
Dmel\VT000109
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000444967
Collection
Associated gene
Genomic Location
Chromosome (arm)
2L
Sequence location

2L:245,396..247,649

Sequence Data
Length
Comments
Associated Information
Gene(s) (targeted or local)
    Allele(s)
    Transcripts(s)
      Polypeptide(s)
        Construct
        Experimental Data
        Progenitors
        PCR template

        genomic DNA

        Primer 1
        GCAGCCGTGCGGTAAGAGTGAGAG
        
        Primer 2
        CCCAGGCCAACAAACACACACAGA
        
        Comments
        Collection Information
        Collection: VDRC_Resources
        Title
        VDRC resources for RNAi in vivo.
        Source and Progenitors
        Species of derivation
        D. melanogaster
        Strain of derivation
        Vector of progenitor construct
        Description
        Additional data
        Sample preparation
        Collection preparation
        Mode of assay
        Data analysis
        Cell lines
        Observed in
        Not observed in
        Comments

        evidence: Reporter construct (in vivo)

        Stocks (0)
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        REDfly - A database of transcriptional regulatory elements
        Synonyms and Secondary IDs (4)
        Reported As
        Symbol Synonym
        Secondary FlyBase IDs
          References (3)