Open Close
General Information
Symbol
Dmel\VT020839
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000446638
Collection
Associated gene
Genomic Location
Chromosome (arm)
2R
Sequence location

2R:22,466,445..22,468,633

Sequence Data
Length
Comments
Associated Information
Gene(s) (targeted or local)
Transcripts(s)
    Polypeptide(s)
      Experimental Data
      Progenitors
      PCR template
      genomic DNA
      Primer 1
      GCTGAATGCATTTTTCTGTTTCCCA
      
      Primer 2
      ATACGCACTCCAGGTAACCCCAGCA
      
      Comments
      Collection Information
      Collection: VDRC-VT
      Symbol
      Title
      A set of GAL4 transgenes under the control of putative enhancer fragments.
      Source and Progenitors
      Species of derivation
      D. melanogaster
      Strain of derivation
      Vector of progenitor construct
      Description
      A collection of stocks carrying GAL4 transgenes fused to putative enhancer fragments from selected D. melanogaster genes; a targeted insertion site is used.
      Additional data
      Sample preparation
      Collection preparation
      7,705 candidate enhancer sequences were PCR amplified from genomic DNA, covering 13.5% of the entire non-coding and non-repetitive genome; genomic fragments were 2kb on average, and typically overlapped ~400bp to avoid splitting enhancers. Candidate enhancer fragments were cloned into the pBPGUw vector, upstream of a Drosophila synthetic core promoter (DSCP) that contains the TATA, Inr, MTE, and DPE sequence motifs, and a Scer\GAL4 reporter gene. These constructs were integrated into the P{CaryP}attP2 target element on chromosome 3L by phiC31 site-specific integration, as described elsewhere (FBrf0205679).
      Mode of assay
      Data analysis
      Cell lines
      Observed in
      Not observed in
      Comments
      Stocks (2)
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (3)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (2)