Open Close
General Information
Symbol
Dmel\VT003229
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000447950
Collection
Associated gene
Genomic Location
Chromosome (arm)
2L
Sequence location

2L:6,397,047..6,399,146

Sequence Data
Length
Comments
Associated Information
Gene(s) (targeted or local)
Transcripts(s)
    Polypeptide(s)
      Experimental Data
      Progenitors
      PCR template

      genomic DNA

      Primer 1
      ATGAGCGGCAAGAGGCACACCC
      
      Primer 2
      TGTATGTGCGATGCTCTATATTGGCCC
      
      Comments
      Collection Information
      Collection: VDRC_Resources
      Title
      VDRC resources for RNAi in vivo.
      Source and Progenitors
      Species of derivation
      D. melanogaster
      Strain of derivation
      Vector of progenitor construct
      Description
      Additional data
      Sample preparation
      Collection preparation
      Mode of assay
      Data analysis
      Cell lines
      Observed in
      Not observed in
      Comments

      evidence: Reporter construct (in vivo)

      Stocks (4)
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      REDfly - A database of transcriptional regulatory elements
      Synonyms and Secondary IDs (4)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (4)