Open Close
General Information
Symbol
Dmel\sgRNA-GS00086.2
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000587502
Collection
Associated gene
Genomic Location
Chromosome (arm)
X
Sequence location

X:18,617,742..18,617,764 [-]

Sequence Data
Length
23
Comments
CGCTGCTACTTAGCCGCACATGG
Associated Information
Gene(s) (targeted or local)
Allele(s)
Transcripts(s)
    Polypeptide(s)
      Construct
      Experimental Data
      Collection Information
      Collection: TRiP-OE-VPR
      Symbol
      Title
      A set of transgenic sgRNA constructs for targeted gene overexpression by dCas9-VPR.
      Source and Progenitors
      Species of derivation
      D. melanogaster
      Strain of derivation
      Vector of progenitor construct
      Description

      A set of transgenic constructs that each consist of two single guide RNAs (sgRNAs) targeting about 500bp upstream of the transcription start site of the targeted gene. The two sgRNAs are under the control of two independent U6 (ubiquitous) promoters. When crossed to a stock that contains a source of nuclease-dead Cas9 fused to a transcriptional activation domain, such as dCas9-VPR, the targeted gene will be overexpressed wherever the dCas9-activator is expressed.

      Additional data
      Sample preparation
      Collection preparation

      pCFD4 vector described at [CRISPR fly design](http://www.crisprflydesign.org/plasmids/)

      Mode of assay
      Data analysis
      Cell lines
      Observed in
      Not observed in
      Comments
      Stocks (0)
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      sgRNA-GS00086.2
      Secondary FlyBase IDs
        References (2)