Open Close
General Information
Symbol
Dmel\sgRNA-WKO.1-G11.2
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000765031
Collection
Associated gene
Genomic Location
Chromosome (arm)
X
Sequence location

X:2,040,862..2,040,881 [-]

Sequence Data
Length
20
Comments
GCTGAGCCACATCAAGGAGG
Associated Information
Gene(s) (targeted or local)
Allele(s)
Transcripts(s)
    Polypeptide(s)
      Experimental Data
      Collection Information
      Collection: Weizmann_CRISPR_reagents
      Title
      Reagents designed for sgRNA-targeted gene mutation, including plasmids and the transgenic constructs generated from them.
      Source and Progenitors
      Species of derivation
      D. melanogaster
      Strain of derivation
      Vector of progenitor construct
      Description
      Additional data
      Sample preparation
      Collection preparation
      Mode of assay
      Data analysis
      Cell lines
      Observed in
      Not observed in
      Comments
      Stocks (0)
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      sgRNA-WKO.1-G11.2
      Secondary FlyBase IDs
        References (1)