Dmel\P{ry11}stau^ry9 Insertion

General Information
Symbol	Dmel\P{ry11}stau^ry9	Species	D. melanogaster
Name		FlyBase ID	FBti0005149
Feature type	transposable_element_insertion_site
Description
Inserted element	P{ry11}	Expression data
Affected gene(s)	stau	Viability / fertility
Causes allele(s)	stau^ry9	Stock availability	1 publicly available
LINE ID
Genomic Location
Chromosomal location	2R ( 55B7 )	Sequence location	2R:14,011,446..14,011,446
Map ( GBrowse )
Recent Updates
Description	What does this section display? This section contains items that were added to this record for each release. It currently only tracks new links between this FlyBase report and other FlyBase data classes (e.g. genes, references, stocks) or controlled vocabulary terms (e.g. GO, anatomy terms). What does this section not display? This section does not currently display links that were removed or gene model changes.
Update Feed	Click the icon below to subscribe to this FlyBase record and receive updates automatically through your feed reader.
FB2012_01
FB2011_10
All updates	Click here to see a list of all updates to this record from FB2010_08 and on.
Detailed Mapping Data
Chromosome (arm)
Sequence Location	2R:14,011,446..14,011,446 (Lowe, 2008.10.31)
Orientation	+ (St. Johnston et al., 1991)
Cytological location (computed by FlyBase)	55B7 ( inferred by FlyBase from sequence location )
Cytological location (reported)
Comments concerning location	Mapped to the region 2R:14010563..14011918 (EcoRI-HindIII restriction fragment); r5 coordinates. The insertion is in a negative orientation with respect to stau gene transcription. (St. Johnston et al., 1991) Sequence from iPCR: AGCCTGAACTACTGGAGGCCGAGCCGAAGGATACTCGCGAACGTCAAGGATAATTGCAGC. (Lowe, 2008.10.31)
Sequence Data
Flanking sequence
Inserted Element
Construct	P{ry11}
Location-dependent role
Size	8.403Kb
Associated alleles	ry^+t7.2
Molecular map
Affected Gene(s)
Insertion may affect gene	stau (St. Johnston et al., 1991, St. Johnston et al., 1991)
Alleles and Phenotypes
Causes alleles	stau^ry9 (St. Johnston et al., 1991, )

Lethality References lethal \| embryonic stage \| maternal effect \| recessive (St. Johnston et al., 1991)
Sterility References
Phenotype Manifest In
	embryonic abdomen \| maternal effect (St. Johnston et al., 1991) embryonic head \| maternal effect (St. Johnston et al., 1991)
Detailed Description
Statement Reference Glial development in the NGB 6-4T lineage is not affected in mutant embryos. (Freeman and Doe, 2001) Typical strong stau phenotype in which the head is reduced in size and is not involuted, and the abdomen in completely absent. (St. Johnston et al., 1991)
Expression Data
Reporter Expression

Additional Information
Statement Reference

Marker for
Reflects expression of
External Images
FlyView (LinkOut)
Data on Genetic Line
Line ID
Origin as a multiple insertion line
Progenitor(s) within the Genome

Related Aberration or Balancer
Aberration
Balancer
Stocks ( 1 )
Bloomington	10742 P{ry11}stau^ry9 cn¹/CyO; ry⁵⁰⁶
Linkouts
Comments
	P insertion maps to an EcoRI-HindIII fragment; Position of restriction fragment on reference sequence inferred by FlyBase curator (St. Johnston et al., 1991)
Synonyms & Secondary IDs
Reported As
Symbol Synonym	Dmel\P{ry11}stau^ry9 (Lowe, 2008.10.31) P{ry11}stau^ry9 (FlyBase, 1992-, St. Johnston et al., 1991, ) P{ry^+t7.2=ry11}stau^ry9 (FlyBase, 1992-)
Secondary FlyBase IDs
	FBti0000935
References ( 4 )
Research paper	Freeman and Doe, 2001, Development 128(20): 4103--4112 Asymmetric Prospero localization is required to generate mixed neuronal/glial lineages in the Drosophila CNS. [FBrf0139636] St. Johnston et al., 1991, Cell 66(1): 51--63 staufen, a gene required to localize maternal RNAs in the Drosophila egg. [FBrf0053380]
Personal communication to FlyBase	Lowe, 2008.10.31, Location of DmelP{ry11}stau[ry9]. Location of Dmel\P{ry11}stau[ry9]. [FBrf0206258]
FlyBase analysis	FlyBase, 1992-, FlyBase curation FlyBase curation. [FBrf0105495]

Dmel\P{ry11}staury9 Insertion

Dmel\P{ry11}stau^ry9 Insertion