Transgenic construct used to study the requirements for amplification of the third chromosome chorion gene cluster. Derived from P{BigParent} : the Ori-β origin of replication has been replaced with a 193bp fragment that includes the complete Saccharomyces cerevisiae ARS1 autonomously replicating sequence (SGD:S000029652).
construct_comment: P{BigParent} in which Ori66Dβ has been replaced by Scer\ARS1 sequence amplified using primers \'AGCTGGATCCCTAACAAAATAGCAAATTTCG\' and \'AGCTCTCGAGACAATCAATCAAAAAGCCAAA\'.
P{BigParent} in which Ori66Dβ has been replaced by Scer\ARS1 sequence amplified using primers \'AGCTGGATCCCTAACAAAATAGCAAATTTCG\' and \'AGCTCTCGAGACAATCAATCAAAAAGCCAAA\'.