Open Close
General Information
FlyBase ID
Feature type
Component Allele(s)
Expression Data
Associated insertion(s)
Molecular map
Description and Uses
Location-dependent role
CV term
Qualifiers and info
Construct components
Component allele Nsf2U6:3.gRNA
Product class / Tool use(s)
Regulatory region(s)

A snRNA:U6:96Ac promoter drives expression of two sgRNAs (GAATGTGTCCGATTTCACGG and CCGCATCCTCGGTAACACGG), each of which target Nsf2 for knockout. The sgRNAs are expressed as a polycistronic cassette based on the tRNA-gRNA design of FBrf0233589.

Sequence Data
Sequence (FB)
Associated Sequence Data
DNA Sequence
Segments and Size
Total Size
Left end
Right end
CV term
Qualifiers and info
Component Alleles
Molecular data

A snRNA:U6:96Ac promoter drives expression of two sgRNAs (GAATGTGTCCGATTTCACGG and CCGCATCCTCGGTAACACGG), each of which target Nsf2 for knockout. The sgRNAs are expressed as a polycistronic cassette based on the tRNA-gRNA design of FBrf0233589.

Expression Data
Reporter Expression
Additional Information
Marker for
Reflects expression of
Reporter construct used in assay
Progenitors and Descendants
Stocks (1)
External Crossreferences and Linkouts ( 0 )
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
Secondary FlyBase IDs
    References (2)